sam

Questions and answers by visitors named sam

Questions

  1. Which of the following was the purpose of the first British colony in Australia?

    A. to benefit from Australia's strategic location B. to extract natural resources C. to house convicted prisoners D. to convert Aborigines to Christianity

  2. Which region was the center of Moorish culture on the Iberian Peninsula?

    A. Castile-León B. Aragon C. Majorca D. al-Andalus

  3. A golf practice range has 245 balls. The owner bought a carton of golf balls.How many golf balls does the owner have after buying the carton?

    Golf Balls 12 balls to a box 15 boxes to a carate 5 crates to a carton pls help by explaining me Thank you

  4. which of the following statements about american romantic poetry is not true?

    A)it followed a fixed rhyme scheme B)its themes originated in British literature C)it was influenced by Gothic literature D)it was filled with emotion

  5. If a boat and its riders have a mass of 800 kg and the boat drifts in at 1.5 m/s how much work does Sam do to stop it?

  6. a volume of 10.0 ml of a 0.00450 M solution of Cl- ions are reacted with 0.500 M solution of AgNO3.What is the maximum mass of AgCl that precipitates?

  7. An unknown metal is found to have a density of 19.300 g/cm^3 and to crystallize in a body-centered cubic lattice. The edge of the unit cell is found to be 0.31627 nm.

    Calculate the atomic mass of the metal. Im not sure how to approach this problem...when i

  8. In 6 hours,an experienced cook prepares enough pies to supply a local restaurant's daily order. Another cook prepares the same number of pies in 7 hours. Together with a third cook, they prepare the pies in 2 hours. Find how long it takes the third cook to

  9. A person weighing 0.6 kN rides in an elevator that has a downward acceleration of 2.3 m/s^2.

    The acceleration of gravity is 9.8 m/s^2. What is the magnitude of the force of the elevator floor on the person? Answer in units of kN

  10. please po help me.

    A chimney projects 6 feet above the roof. At a point 10 feet 8 inches down the roof from the base of the chimney,the chimney subtends an angle of 17°40' . find the angle at which the roof is inclined to the horizontal.

  11. A helicopter weighs 3920 newtons, caculated the force on it if it is ascending up at a rate of 2m/s squre ,what wil b force on helicopter if it is moving up with the constant speed of 4m/s .

  12. Find the area of the region enclosed between y=2sin(x and y=3cos(x) from x=0 to x=0.4pi

    Hint: Notice that this region consists of two parts. Notice: I'm getting 1.73762 but apparently that is wrong.

  13. what is the molality of a 10.5% by mass glucose solution?. density of the solution is 1.03g/ml

    can someone please explain how to do this question. please and thank you

  14. A boat's crew rowed 12 miles downstream, with the current, in 1.5 hours. The return trip upstream, against the current covered the same distance, but took 4 hours. Find the crew's rowing rate in still water and the rate of the current...

    The crew's rowing

  15. Consider a window the shape of which is a rectangle of height h surmounted by a triangle having a height T that is 1.1 times the width w of the rectangle

    If the cross-sectional area is A, determine the dimensions of the window which minimize the perimeter.

  16. Consider the following substance:

    Al2(SO4)3 What is the oxidation number of: a) aluminum b) sulfur c)oxygen

  17. if it takes 31,500 joules of heat to warm 750g of water, what was the temperature change?

    My answer: Q = (M) (DeltaT) (c) Delta T=Q Delta T = 31,500J -------- 750gx 1.0cal/gCo Delta T = 42oC

  18. When a 644 lb boat is moving at 10fps, the motor conks out. How much farther will the boat

    glide, assuming its resistance to motion is 2v lb where v is in fps.

  19. A tennis ball with a speed of 28.3 m/s is

    moving perpendicular to a wall. After striking the wall, the ball rebounds in the opposite direction with a speed of 14.6311 m/s. If the ball is in contact with the wall for0.013 s, what is the average acceleration

  20. An aircraft flies at an altitude of 30,000 feet. Determine the air temperature (in [K]), air pressure (in [Pa]) and air density (in [kg/m3]) at this altitude, according to the standard atmosphere.

  21. In a police ballistics test, a 10.0-g bullet moving at 300 m/s is fired into a 1.00-kg block at rest. The bullet goes through the block almost instantaneously and emerges with 50.0% of its original speed. What is the speed of the block just after the

  22. The quotient of a number and 3, minus 1, equals 5/3. Find the number.

  23. a 20 kg loudspeaker is suspended 2m below a ceiling by two 3m-long cables that angle outward at equal angles. what is the tension in the cables?

  24. Two dice are rolled. Find the odds that the score on the dice is either 7 or 12. Am I doing this right?

    There are only 3 ways to equal 7 on two dice 6+1,5+2,4+3 so there is a 3/12 chance that I roll a 7 and a 1/12 chance of rolling a 12. my chances of

  25. Suppose T is a transformation from ℝ2 to ℝ2. Find the matrix A that induces T if T is reflection over the line y=−5/3x.

  26. During a baseball game, a batter hits a high

    pop-up. If the ball remains in the air for 6.36 s, how high does it rise? The acceleration of gravity is 9.8 m/s 2 . Answer in units of m.

  27. Which of the following technologies required the measurement of the stars for navigation?

    A. compass** B. lateen C. Mercator projection D. astrolabe

  28. Between 1860 and 1914, what was the destination of 90 percent of European emigrants?

  29. a piece of clay with a mass of 0.30 kg is tied to the end of a string 6.5 meters in length, and then whirled around in a horizontal circle at a speed of 6 m/s. a. what is the centripetal acceleration of the clay? b. what is the tension of the string?

  30. A shipment of 9 printers contains 4 that are defective. Find the probability that a sample of size 4​, drawn from the​ 9, will not contain a defective printer .

    the probability is ?

  31. The loudness,

    L L, of a sound (measured in decibels, dB) is inversely proportional to the square of the distance, d d, from the source of the sound. Round to 3 decimal places. A person 15 feet from a jetski, it is 75 decibels loud. How loud is the jetski

  32. Sara estimated 23 x 43 using 20 x 40.

    Sam estimated 23 x 43 using 25 x 40. Will Sara's or Sam's method give an estimate closer to the exact answer?Explain.

  33. The blood vascular system consists of blood vessels (arteries, arterioles, capillaries, and veins) that convey blood from the heart to the organs and back to the heart. This system should work so as to minimize the energy expended by the heart in pumping

  34. An igneous rock contains a Pb−206/U−238 mass ratio of 0.367.

    How old is the rock? (U−238 decays into Pb−206 with a half-life of 4.50×109 yr.) I'm not sure how to get started on this :/

  35. A normal population has mean 100 and variance 25. How large must the random sample

    be if we want the standard error of the sample average to be 1.5? I know the answer is 12. Would someone please be able to explain! and share what formula they used

  36. The velocity of a ball changes from ‹ 8, −5, 0 › m/s to ‹ 7.88, −5.28, 0 › m/s in 0.04 s, due to the gravitational attraction of the Earth and to air resistance. The mass of the ball is 140 grams.

    I calculated the acceleration and got <-3,-7,0>

  37. An ungraduated mercury thermometer attached to a millimeter scale reads 22.8 mm in ice and 242mm in steam at standard pressure. What will the millimeter read when the temperature is. 20oC?

  38. calculate the percentages by mass of the component element in sodium trioxonitrate(v)

  39. a sample of methane gas of mass 25g at 250k and 18.8atm expands isothermally until its pressure is 2.5atm. calculate the change in entropy.

  40. An internet company charges $30 a month. There is also a $30 installation fee. Is the number of months you can have internet proportional to the total cost?

  41. The GCF of two numbers is 850. Neither number is divisible by the other. What are the least two numbers these could be.

  42. Gregg has q quarters and p pennies. His brother has 4 times as many quarters and 8 times as many pennies as gregg has. Write the sum of the numbers of coins they have, and then combine like terms

  43. After six biology tests, Ruben has a mean score of 73. What score does Ruben need on the next test to raise his average (mean) to 75?

  44. A large uniform chain is hanging from the ceiling, supporting a block of mass 48kg. The mass of the chain itself is 15 kg, and the length of the chain is 2.6 m.

    The acceleration of gravity is 9.81 m/s^2 Find the tension in the chain at the point where the

  45. Finding molarity and molality(best answer)?

    An aqueous solution is prepared by diluting 3.30 mL acetone,(d= 0.789g/mL) with water to a final volume of 75.0 mL. The density of the solution is 0.993 g/mL. What is the molarity, molality and mole fraction of

  46. Air consits of 21% oxygen, 78% nitrogen and 1% argon by volume. Calculate the partial pressures in Pa if total pressure is 1 atm.

    My teacher just converted 1atm in pa and then did 21% of that for oxygen etc etc. Can you explain why she did this, is volume

  47. Mr. Roper owns 20 apartment buildings. Each building contains 15 units that he rents for $800 per month each. Design the application that would print 12 payment coupons for each of the 15 apartments in each of the 20 buildings. Each coupon should contain

  48. an electric drill rated at 400 W is connected to a 240 v. how much current does it draw?

    explain your answer

  49. oil is leaking from a pipeline on the surface of a lake and forms an oil slick whose volume increases at a constant rate of 2000 cubic centimeters per minute. The oil slick takes the form of a right circular cylinder with both its radius r and height

  50. if the specifc heat of iron = 0.46J/g C,how much heat is needed to warm 50g of iron from 20C to 100C

    -- I do not know how to make the celcius o above the temperature number my anwswer Q = Mx(delta)TxC Q=50gx80Cx0.46J/gC Q = 1840 Joules Delta = the triangle

  51. A total of 180 marbles (gray, white, and black) are placed in a line. If the first five are gray, followed by four, followed by three black, followed by five gray, followed by four white, followed by three black,... If this pattern continues, what is the

  52. Spanish 1B - I am an honor student but with spanish for me I can memorize for the tests but I am not really undestanding it. I am great in science and math - and i got an A barely in spanish but it gets harder. The hardest part for me is that every other

  53. Define “carbon source” and “carbon sink.” Give two examples of each.

  54. What do the Etowah Mounds tell us about prehistoric societies in Georgia (think about tools, resources, culture, etc.)?

  55. You have the choice of flipping a fair coin and winning a game when heads​ appear, or you can roll a single standard die and you win if an even number appears. Explain why the choice of coin or die does not matter in regard to your winning.

  56. 495,346 to 500,000

  57. The density of osmium (the densest metal) is 22.57 g/ cm3. If a 1.00 kg rectangular block of osmium has two dimensions of 4.00 cm x 4.00 cm, calculate the third dimension of the block.

  58. Lillie read an average of 5 books per month in the first nine months of the year. In the last three months of the year, she read an average of 6 books per month. How many books did Lillie read during the year?

  59. Mr Badger buy 12 pens for $x each. The price of the pens have now increased by 15

    cents each. And he can only afford to buy 10 pens at the same total cost as before. What was the original price of each pen?

  60. A woman weighs 125 lbs on the surface of the earth ( radius = 3960 miles). At what distance above the surface of the earth would she weigh 85 lbs?

  61. What is the relative frequency of male passengers?

    Round to the nearest hundredth, if needed. 0.15 0.27 0.43 0.75

  62. Find the interval(s) where the function is increasing and the interval(s) where it is decreasing. (Enter your answers using interval notation. If the answer cannot be expressed as an interval, enter EMPTY or ∅.)

    f(x) = 5x2 + 9x + 8

  63. How did the role of the church in education change over time?

    A.Universities changed from being independent to being part of the church. B.Priests became the only teachers at universities. C.Schools began to provide education beyond religious instruction.

  64. jonathan sabastion batch composed much of his music around what insurment family? (1 point)

    a.brass b.percussion c.keybord d.electronic

  65. all answers please:

    Are rocks considered valuable natural resources?(1 point) a.No, rocks are not valuable because they are nonliving solids. b.No, rocks are not valuable because they contain a lot of waste. c.Yes, rocks are valuable because they are part

  66. hello smart people i need a little help please can anyone help with this practice quiz please. (if not please move along iv been getting a lot of hate reacently that i really dont need.) you see my dad has covid right now and its BAD he may not make it

  67. hello BEUTIFULL people 🥰 can you please help me whith this quiz

    Which of the following was one major effect of the bubonic plague? A.It killed nearly one third of the population of Europe. B.It drove many poor people from cities to manors. C.It

  68. 1.find the area of the tryangle (1 point)

    a.16.4 b.11.55 c.23.1 d.4.55 but i dont want answers i just need help i do read my lesson notes and even went back to check but its just not helping so i was wondering if any fellow smart people can help PLEASE.

  69. two forces 4n and 5n act on a body in direction due north and due east respectively calculate their equilibria

  70. (c) Given the DNA shown below …

    3’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 5’ 5’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 3’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA

  71. b) BclI cleaves after the first T:

    3’ TGATCA 5’ 5’ ACTAGT 3’ Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang? [1]

  72. a) BamHI, cleaves after the first G:

    3’ GGATCC 5’ 5’ CCTAGG 3’ Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang? [1]

  73. slope 5/4 passing through -1,9

  74. In the function y= 5cos(x+ 2π/3)-6 is translated K unit up words resulting in a Maximum y-value of 14, the value of K is _____.

  75. For the trigonometric function y = tan(¾ x), the period can be expressed as aπ/b radians.

  76. A 25 kg object travels at 52 m/s West collides with a 39 kg object at rest. If the object sticks together on contact, the resulting velocity of the combined masses is ab m/s.

    Let's west be positive

  77. A shortage of gold causes the price of gold wire to increase by 140%. If 10 feet of gold wire previously cost $50, what is the new cost of gold wire?

  78. what 2 numbers greater than 40 have only 2 or 3 for prime numbers

  79. I am an even multiple of 2. If you reverse my digits, I become a multiple of 9. Who am I?

  80. Blake’s balance in his checking account at the beginning of the month was $42.68. Blake’s bank statement for this month showed the following withdrawals and deposits in his checking account: $35.42, $-13.55, $52.12, $11.50, $-17.33, $-21.45.

    How much

  81. risky behaviour of a social

  82. The difference between static friction and kinetic (sliding) friction is that

  83. Suppose that the average pop song length in America is 4 minutes with a standard deviation of 1.25 minutes. It is known that song length is normally distributed. Suppose a sample of 25 songs is taken from the population. What is the approximate probability

  84. what are the dimentions of three different rectangular prisms that each have a surface area of 72?

  85. In a amusement park ride, gondola cars of weight W are attached by rods 24ft long to a bull

    wheel 16ft in diameter. The bull wheel rotates in a horizontal plane about a vertical axis at its center. At how many rpm is it rotating when the supporting rods of

  86. A magnetic particle weighing 3.6 grams is pulled through a solenoid with an acceleration of

    6m/s2. Compute the force in pounds acting on the particle.

  87. For Set A, how many of the numbers are greater than 42? _____

    Set A 1|0 2|1 1 4 4 3|5 4|0 1 3 5|0 1

  88. Referring to the Fig. in Question #22, think about first picking a card and then

    rolling the die. Give the probability in simplest form. P(not C, odd) = _____ (cards 1 a 2 b's 3 c's ) (dice) 6 sided rolled on 2

  89. The Downtown Theater has 1 ticket window. In how many ways can 4 people

    line up to buy tickets?

  90. The Downtown Theater has 1 ticket window. In how many ways can 3 people

    line up to buy tickets? _____

  91. You bought one $2 chance on an $84 radio. Sixty chances were sold. What

    is your expectation? ( not 0.57)

  92. Suppose the cards shown are mixed and placed facedown. Think about

    drawing a card and without replacement drawing a second card. Give the probability in simplest form: P(not A, A) = _____ ————— ————— ————— —————

  93. Suppose the cards shown are mixed and placed facedown. Think about

    drawing a card and without replacement drawing a second card. Give the probability in simplest form: P(C, not B) = _____ ————— ————— ————— —————

  94. Stereo Inc. sells a stereo system for $400 down and monthly payments of $60 for the next 3 years. If the interest rate is 4.5% per year, find:

    a) The cost of the stereo.

  95. 4x^2+8x+3=0

  96. the sum of two number is 16 and thier diffrerence

  97. if the measure of angle 7 is 2x and the measure of angle 8 is 4x what does x equal

  98. find three consecutive even integers such that the product of the second and the third exceed the product of the first and third by 20.

  99. Which one is incorrect?

    A-Each of the players have a locker. B-There go the members of the cast. C-Neither of the reports is finished. D-Either of the clients is angry.

  100. Read this stanza from “The Song of Wandering Aengus” by William Butler Yeats.

    I went out to the hazel wood, Because a fire was in my head, And cut and peeled a hazel wand, And hooked a berry to a thread; And when white moths were on the wing, And

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17