Questions LLC
Login
or
Sign Up
Ask a New Question
Biology
Organisms
Naming
I need help with the names of this organism
1 answer
The organism you are referring to is not specified, so it is not possible to provide an answer.
You can
ask a new question
or
answer this question
.
Similar Questions
Binomial (two) nomenclature (names) is a way to write the scientific name of an organism, using the genus and species of that
Top answer:
Ursus maritimus (polar bear) and Falco peregrinus (peregrine falcon) are correctly written in Genus
Read more.
What makes up the scientific name of an organism? Why is it important to use scientific names rather than common names?
Top answer:
This site has an excellent explanation. http://herbarium.usu.edu/fungi/FunFacts/Name_Game.html
Read more.
A scientist discovered a microscopic, unicellular organism with no nucleus. Which of the following correctly describes the
Top answer:
Lesson 3:Science 6B Mini Module Test Unit 4 1:C 2:D 3:C 4:B 5:C 6:D 7:abiotic 8:Do you’re self
Read more.
Which statement describes a consumer/producer relationship?
A. One organism eats another organism that makes its own food B one
Top answer:
C. Both organisms benefit from each other
Read more.
Which statement describes a consumer/producer relationship?(1 point)
Responses One organism catches and consumes another
Top answer:
One organism that benefits from living in or on another organism at the expense of that organism.
Read more.
Which statement describes a consumer/producer relationship?
Both organisms benefit from each other. One organism that benefits
Top answer:
One organism eats another organism that makes its own food.
Read more.
A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following
Top answer:
so the answer is A.
Read more.
Here are parts of the DNA base sequences for 7 organisms:
Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2:
Top answer:
Since Jiskha doesn't have a biology expert at this time, please try posting your question at this
Read more.
Which statement describes a consumer/producer relationship?
a One organism eats another organism that makes its own food. b One
Top answer:
b
Read more.
Which statement describes a consumer/producer relationship?
A. One organism eats another organism that makes its own food. B. One
Top answer:
C. Both organisms benefit from each other.
Read more.
Related Questions
Assume that 22 kids have their names (all different) put into a hat. The teacher is drawing 5 names to see who will speak first,
What is the main benefit of using scientific names instead of common names for organisms?
Scientific names have been around for
A student uses a microscope to study a unicellular organism. He sees that the organism has extended a pseudopod. What is the
1. List 4 reasons biologists use scientific names instead of common names in their communications.
Answer 1. Scientific names
A) Your teacher describes an organism that digests its food externally before absorbing it. You also find out that this organism
Binomial (two) nomenclature (names) is a way to write the scientific name of an organism, using the genus and species of that
Which statement describes a consumer producer relationship? A1 organism eats another organism that makes its own food be one
Which statement describes a consumer/producer relationship?(1 point)Responses
1.One organism catches and consumes another
As he thought about the hieroglyphs in Thothmes' and Ramesses' names, Champollion realized their significance. It went far
A scientist is trying to classify a new organism. She observes that the organism is a microorganism. It is prokaryotic, and
