Finally - using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.

Question

Finally - using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.

aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Answer 1

I. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

answer:

serine-cysteine-tyrosine-arginine-lysine-leucine-arginine-valine-asparagine-isoleucine-leucine-arginine-arginine-serine-aparagine

I. If u is removed:

agu ugu auc gaa aac ugc gag uaa aua ucc uga ggg cgc gaa gca acc

serine-cysteine-isoleucine-glutamic acid-asparagine-cysteine-glutamic acid-stop codon

II. agu ugu auc gaa aac ugc gag uaa aua ucc uga ggg cgc gaa gca acc

answer:

serine-cysteine-serine-glutamic acid-serine-cysteine-glutamic acid-leucine-isoleucine-serine-stop codon

**once stop codon is reached, the translation process of protein will be terminated. STOP CODONS ARE UAG, UGA, UAA

Answer 2

Well, let's try to translate these RNA strands and see what we get!

RNA Strand 1: AGUUGUUAUCGAAAAUCUGCGAGUAAAUAUCCUGAGGGCGCGAAGCAACC

Using the codon table, let's break it down:

AGU-UGU-AUC-GAA-AAC-UGC-GAG-UAA-AUA-UCC-UGA-GGG-CGC-GAA-GCA-ACC

Now, let's find the corresponding amino acids for each codon:

AGU = Serine (S)
UGU = Cysteine (C)
AUC = Isoleucine (I)
GAA = Glutamic Acid (E)
AAC = Asparagine (N)
UGC = Cysteine (C)
GAG = Glutamic Acid (E)
UAA = Stop codon
AUA = Isoleucine (I)
UCC = Serine (S)
UGA = Stop codon
GGG = Glycine (G)
CGC = Arginine (R)
GAA = Glutamic Acid (E)
GCA = Alanine (A)
ACC = Threonine (T)

So, putting it all together, the peptide sequence for RNA Strand 1 is: S-C-I-E-N-C-E-E-I-S-S-G-R-E-A-T.

Now, let's move on to RNA Strand 2 which has a point deletion:

AGUUGUAUCGAAAAUCUGCGAGUAAUCCUGAGGGCGCGAAGCAACC

Breaking it down:

AGU-UGU-AUC-GAA-AAC-UGC-GAG-UAA-UCC-UGA-GGG-CGC-GAA-GCA-ACC

And finding the corresponding amino acids:

AGU = Serine (S)
UGU = Cysteine (C)
AUC = Isoleucine (I)
GAA = Glutamic Acid (E)
AAC = Asparagine (N)
UGC = Cysteine (C)
GAG = Glutamic Acid (E)
UAA = Stop codon
UCC = Serine (S)
UGA = Stop codon
GGG = Glycine (G)
CGC = Arginine (R)
GAA = Glutamic Acid (E)
GCA = Alanine (A)
ACC = Threonine (T)

Putting it all together, the peptide sequence for RNA Strand 2 is: S-C-I-E-N-C-E-E-S-S-G-R-E-A-T.

As you can see, the deletion of the "U" in the second strand didn't affect the peptide chain. It seems like the genetic code is quite forgiving when it comes to small deletions like this! Just like how I forgive your mistake when you forgot to ask for a joke. Don't worry, I got your back!

Answer 3

To translate the given RNA strands into peptide sequences, we will use the codon table found in Figure 15.4 in Chapter 15 of the textbook. Let's start with the first RNA strand:

1st RNA strand: aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Breaking it into codons:
AGU UGU AUC GAA AAC UGC GAG UAA UAU CCU GAG GGC GCG AAG CAA CC

Using the codon table, we can determine the amino acid corresponding to each codon:
AGU -> Serine (S)
UGU -> Cysteine (C)
AUC -> Isoleucine (I)
GAA -> Glutamic Acid (E)
AAC -> Asparagine (N)
UGC -> Cysteine (C)
GAG -> Glutamic Acid (E)
UAA -> Stop codon
UAU -> Tyrosine (Y)
CCU -> Proline (P)
GAG -> Glutamic Acid (E)
GGC -> Glycine (G)
GCG -> Alanine (A)
AAG -> Lysine (K)
CAA -> Glutamine (Q)
CC -> Proline (P)

Therefore, the peptide sequence for the first RNA strand is: SCEINCEYPPGEAKQP.

Now, let's move on to the second RNA strand, which has a point deletion (the bolded 'u'):

2nd RNA strand: aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Breaking it into codons:
AGU UGU AUC GAA AAC UGC GAG UAA UAU CCU GAG GGC GCG AAG CAA CC

Using the codon table, we can determine the amino acid corresponding to each codon:
AGU -> Serine (S)
UGU -> Cysteine (C)
AUC -> Isoleucine (I)
GAA -> Glutamic Acid (E)
AAC -> Asparagine (N)
UGC -> Cysteine (C)
GAG -> Glutamic Acid (E)
UAA -> Stop codon
UAU -> Tyrosine (Y)
CCU -> Proline (P)
GAG -> Glutamic Acid (E)
GGC -> Glycine (G)
GCG -> Alanine (A)
AAG -> Lysine (K)
CAA -> Glutamine (Q)
CC -> Proline (P)

As you can see, the deletion of the 'u' in the second strand does not affect the resulting peptide chain. Both strands produce the same peptide sequence: SCEINCEYPPGEAKQP. The deletion of a single base has not caused a frameshift mutation, as the subsequent codons and their corresponding amino acids remained the same.

Answer 4

To translate the RNA strands into peptide sequences, we need to use the codon table found in Figure 15.4 in Chapter 15 of the textbook. Let's begin by breaking down the RNA strand into codons.

The first RNA strand is:
agu-ugu-auc-gaa-aac-ugc-gag-uaa-aua-ucc-uga-ggg-cgc-gaa-gca-acc

The codons in this strand would be:
agu - ugu - auc - gaa - aac - ugc - gag - uaa - aua - ucc - uga - ggg - cgc - gaa - gca - acc

Now, let's translate each codon using the codon table to determine the corresponding amino acid.

Codons and their corresponding amino acids:
agu - serine (Ser)
ugu - cysteine (Cys)
auc - isoleucine (Ile)
gaa - glutamic acid (Glu)
aac - asparagine (Asn)
ugc - cysteine (Cys)
gag - glutamic acid (Glu)
uaa - stop codon (termination)
aua - isoleucine (Ile)
ucc - serine (Ser)
uga - stop codon (termination)
ggg - glycine (Gly)
cgc - arginine (Arg)
gaa - glutamic acid (Glu)
gca - alanine (Ala)
acc - threonine (Thr)

Therefore, the peptide sequence for the first RNA strand is:
Ser-Cys-Ile-Glu-Asn-Cys-Glu-termination-Ile-Ser-termination-Gly-Arg-Glu-Ala-Thr

Now, let's move on to the second RNA strand, which has a point deletion of the "u" base.

The second RNA strand is:
agu-uguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

The codons in this modified strand would be:
agu - ugu - auc - gaa - aac - ugc - gag - uaa - aua - ucc - uga - ggg - cgc - aag - caacc

Now, let's translate each codon using the same codon table as before.

Codons and their corresponding amino acids:
agu - serine (Ser)
ugu - cysteine (Cys)
auc - isoleucine (Ile)
gaa - glutamic acid (Glu)
aac - asparagine (Asn)
ugc - cysteine (Cys)
gag - glutamic acid (Glu)
uaa - stop codon (termination)
aua - isoleucine (Ile)
ucc - serine (Ser)
uga - stop codon (termination)
ggg - glycine (Gly)
cgc - arginine (Arg)
aag - lysine (Lys)
caacc - glutamine (Gln)

Therefore, the peptide sequence for the second RNA strand is:
Ser-Cys-Ile-Glu-Asn-Cys-Glu-termination-Ile-Ser-termination-Gly-Arg-Lys-Gln

Comparing the resulting peptide chains from both RNA strands, the deletion of the "u" base in the second strand has caused a frame shift in the reading frame of the codons. This leads to a completely different sequence of amino acids in the resulting peptide chain. The deletion disrupts the codon alignment, resulting in a different translation of the RNA strand.