Ask questions and get helpful answers.

Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3' and 5' ends).

a. DNA 3'-TACCTACTTTGCCCGATCCAT-5'
mRNA

b. DNA 5'-TACCTACTTTGCCCGATCCAT-3'
mRNA

  1. 👍
  2. 👎
  3. 👁
  4. ℹ️
  5. 🚩
1 answer
  1. A - 5-3
    UACCUACUUUGCGCGTAUCCAT
    B - 3-5
    UACCUACUUUGCCCGAUCCAU

    1. 👍
    2. 👎
    3. ℹ️
    4. 🚩

Answer this Question

Related Questions

Still need help?

You can ask a new question or browse existing questions.