Questions Asked on
January 24, 2023

  1. Sabine drew two points on a number line.

    The number line is divided into 12 equal segments. From left to right, alternative segment has -10, -8, -6, -4, -2, and 0, and 1 is at twelfth segment. The first point is at -8 and the second point is at -4. Which

  2. Are rocks considered valuable natural resources?(1 point)

    Responses No, rocks are not valuable because they are nonliving solids. No, rocks are not valuable because they are nonliving solids. Yes, rocks are valuable because they are part of Earth’s crust.

  3. When white light strikes this object, the light is completely absorbed, with none of it transmitted or reflected. Which type of object could this be?

    - a black piece of paper - a clear windowpane - a white sheet of plastic - a green long-sleeved shirt Which

  4. Patrice is considering applying to become a Secret Service agent. She is 20 years old, in good physical health, and has a valid driver's license. She lived in Brazil for a while but was born in California. Patrice doesn't have a college degree, but she

  5. What is an example of a frame narrative?(1 point)

    Responses "Cinderella" "1,001 Nights" "The Little Mermaid" "Aladdin and the Magic Lamp"

  6. Which elements help an author to develop a theme?

    Plot, style, and point of view tone, point of view and characters character, plot and setting length setting and conflict

  7. (1 Abrasion occurs due to _____. answer : D friction)

    (2 Which describes a characteristic of water that is responsible for frost wedging : D Water expands as it freezes) (3 A student wants to model the physical weathering of rock. Which activity could the

  8. Melissa and Thomas both solved the same problem using different methods.

    Melissa's method shows 12 as divisor, 1784 as dividend and 107 as quotient. The first row below 1784 has -12, the second row has 8, the third row has -0, the fourth row has 84, the

  9. Victor cut four congruent triangles off the corners of a rectangle to make a hexagon, as shown below.

    A rectangle that is 28 c-m long and 16 c-m wide has right triangles cut out from all four corners each with height and base length of 8 c-m. What is the

  10. Which description best defines a main idea?

    The description of characters in a text the theme of a text the summary of symbols in a text the summary of events in a text

  11. The display below shows the number of strikeouts recorded by the four pitchers on Jefferson High School's softball team.

    The display titled Jefferson high school softball pitchers shows strikeouts recorded for the each players as 4 balls for Jackie, 3 balls

  12. hal surveyed all the sixth graders at his school about their favorite animal. the table shows the results

    horse 21 bird 35 cat 35 dog 49 Which percentage graph best represents the data

  13. Which of the following describes the theme of a story?(1 point)

    Responses a statement that gives the most important facts of the story the key details regarding characters and plot a message about life that is explored and expressed the idea that connects

  14. Which is a true statement about the power of congress?

    A. Congress may overrule the Bill of Rights B. Congress may pass any law necessary and proper to carry out its enumerated powers C. Congress may overrule decisions of federal judges D. Congress may

  15. Which statement about federalism is true?

    A. Federalism gives more power to states than to the national government B. Federalism gives all power to the national government C. Federalism is a compromise between a unitary and a confederate government D.

  16. Compare and Contrast Neolithic V.S. Paleolithic Essay

    PLEASE PROVIDE EVIDENCE

  17. compare and contrast neolithic and paleolithic

    please write an essay

  18. Does the equation x2+y=16 define y as a function of x?

  19. Does the equation x^2+y=16 define y as a function of x?

  20. Confidence interval

  21. A case in which a group or individual claims that another group or individual has done their wrong is called

  22. A case in which the government claims that a person or group has committed a crime is called a

  23. Which of the following describes the theme of a story?

    • a message about life that is explored and expressed • the idea that connects the story's parts • the key details regarding characters and plot • a statement that gives the most important facts

  24. What happens to air pressure and the amount of oxygen as the altitude increases in Earth’s atmosphere?

    • Both air pressure and the amount of oxygen decrease. • Air pressure increases, while the amount of oxygen decreases. • Both air pressure and the

  25. Effects of undercapitalizaton

  26. Note: Enter your answer and show all the steps that you use to solve this problem in the space provided.

    d−21.4=87.9

  27. Which of the following organizations might help you learn how to be financially literate?(1 point)

    A.the IRS B.the Department of the Treasury C.Goldman Sachs D.the Finance Bar Why is it important to track your income and your expenses?(1 point) A.because

  28. Solve

    t/16=40/50 1) 26 2) 28 3)1.28 4)12.8

  29. n three to five sentences, describe how the diagram of Earth’s carbon cycle demonstrates the interactions among the biosphere (plants), the lithosphere (ground), the atmosphere (air), and the hydrosphere (water).

  30. Which of the following expressions can be written as (ax+b)(ax-b), where a and b are integers? Select all that apply. A. x^2- 9 B. x^2-11 C. 4x^2-1 D. 4x^2-2 E. 9x^2-4

  31. What happens to light as it. Passes through a blue sports drink

  32. The equation x^2 - 8x - 5 = 0 xan be transformed into the equation (x - p)^2 = q, where p and q are real numbers. What is the value of q?

  33. Full Counter Claim Quick Check Answers!

    Item 1: What is a claim? the statement of an argument Item 2: What is used to support a claim? evidence Item 3: What is the purpose of an argument? to share an opinion that is supported by evidence Item 4: How do

  34. Which of the following can represent the measure of the three angles in an acute triangle

  35. Which choice describes an allusion

    A. A part of speech. B. A figure of speech. C. A sound device. D. And interpretation.

  36. Which statement best describes the reflection of a wave?

    A.) A wave transfers its energy to a material. B.) A wave fails to reach the surface of a material. C.) A wave passes through a material. D.) A wave bounces off the surface of a material.

  37. How is an echo formed?

    A.) Sound waves travel into a soft surface. B.) Light waves go around a smooth surface. C.) Sound waves bounce off a flat surface. D.) Light waves pass through a shiny surface.

  38. Post your World Heritage Recommendation from the Communicate, Collaborate, Connect slide

  39. During warmer parts of the day, fish will be found in deeper waters of a lake. Which statement best explains this phenomena with respect to the solubility of a gas?

    A. Gases are more soluble at low pressures. B. Gases are more soluble at high pressures. C.

  40. You do remember?

  41. What does explicit mean?information that is stated directly

    information that is stated directly information that is inferred information that is inferred information that is understood from context information that is understood from context information

  42. Katie's swim team is having an end-of-season pizza party. When the party started, there were 50 slices of pizza. Now there are 20 slices left. Which of the following shows how much of the pizza has been eaten?

    A. 20/50 B. 60% C. 40% D. 40/100

  43. Jason collects baseball cards. He has 280 cards. Of these, 40% feature players from the New York Yankees baseball team. How many baseball cards does Jason have that feature players from teams other than the New York Yankees?

    A. 60 cards B. 112 cards C. 168

  44. Angie bought

    pounds of apples to make a pie. There are 16 ounces in one pound. How many ounces of apples did she buy? A. 16 B. 35 C. 56 D. 74

  45. How did Francisco Goya used caricature to depict the figures in contemptuous of the insults

  46. i need help with Fossil Fuels and Climate Change Quick Check

  47. Water boils at 100°C and turns into steam. Which similarities or differences are there between water at 100°C and steam at 100°C? (1 point)

    Responses The particles will have more space between them and will be moving at higher speeds as steam. The

  48. In which layer of Earth's atmosphere does weather occur

  49. Why does clearing forests using fire contribute to the greenhouse effect

  50. And three to five sentences describe how the diagram of Earth's carbon cycle demonstrates the interactions among the biosphere the lithosphere and the atmosphere and the hydrosphere

  51. Sonny packed a number of boxes, x, with 22 cans in each box. The total number of cans packed was 660. Which equation and solution represent the total number of boxes Sonny packed?

    A. x – 22 = 660 x = 682 boxes B. x ÷ 22 = 660 x = 30 boxes C. 22 + x = 660

  52. The 5 employees at Jewelry Hut are scheduled to work an average of 31 hours each next week, as shown below.

    A table labeled Employee hours scheduled. Alan has 24 hours, Susan has 39 hours, Craig has 24 hours, Mary has 40 hours and Scott has 28 hours. The

  53. Melissa and Thomas both solved the same problem using different methods.

    Melissa's method shows 12 as divisor, 1784 as dividend and 107 as quotient. The first row below 1784 has -12, the second row has 8, the third row has -0, the fourth row has 84, the

  54. Determine loan amount

  55. What is a mnemonic device?

  56. Which of the following were characteristics of Ancient Greek literature? Select the two correct answers.

  57. Which of the following was NOT a policy goal of Theodore Roosevelt's "Square Deal" for Americans?

    1 point Theodore Roosevelt wrote this letter where he stated: "All I ask is a square deal for every man. Give him a fair chance. Do not let him wrong any one,

  58. Explain why animal cells do not require a cell wall or a central vacuole

  59. Which of the following is the central idea of a story one and message that the author expresses to key details and text too the idea of the connects the story parts three details in the story for the qualities of the main characters

  60. What would be the most common cause of deterioration to a fifteenth-century book?

    A. Rodent damage B. Mold C. Corrosion D. Natural disaster

  61. Which of the following describes how the structure of feudalism in Europe worked?

    A. There was a council of vassals; peasants voted for council members to represent them. B. The king chose people to serve on a senate; the serfs voted for people to serve as

  62. 321409 to nearest 100000

  63. 976315463 nearest 100000

  64. Solve 14x−34>514.

  65. Use the photograph of people paying New Year's calls to answer the question. The image indicates that, in the 1800s,

    A. diverse cultural groups brought their traditions to the United States. B. it was easy for members of distinct ethnic groups to blend with

  66. What happens to light as it passes through a blue sports drink

  67. Brianne is making apple pies. She has

    pounds of apples. Brianne estimates she can make 3 pies with no apples left over. What assumption did Brianne use to make this estimate? A. Each pie will need pounds of apples. B. Each pie will need pounds of apples. C.

  68. Solve:

    5x + 7 = 2x - 9 Responses x=−1112 , x is equal to negative 11 over 12 x=316 , x is equal to 3 over 16 x=−163 , x is equal to negative 16 thirds x=163

  69. Solve 14x−34>514.(1 point)

    Responses A: x>24 B: x>21 3/4 C: x>1 1/2 D: x>18

  70. I have the answers for Determining Genre Quick Check

    1. which option is an example of a subgenre of poetry B- epic 2. Which of the following best describes a short text that reveals a moral or lesson and serves as a warning? D- Fable 3. which of the

  71. 1. What is a chloroplast? Explain how a root of a plant, that lacks Chloroplasts, gets energy. What organelles are involved with converting the energy for the roots?

    2. Explain why animal cells do not require a cell wall or a central vacuole.

  72. Question

    Which of the following is connotation? A: a comparison between two words B: a more imaginative meaning of a word C: the literal meaning of a word D: the feelings suggested by a word

  73. Michael used a stopwatch to time the baseball pitches for three of his friends. The times are listed in the table.

    The table shows pitching times in seconds. Pete pitched in 0.537 seconds, Ivan pitched in 0.58 seconds, and KaShawn pitched in 0.4996 seconds.

  74. Triangle DEF has vertices of ,D(-7,-1),E(-7,-8), and F1,-8) .  Which of these statements is true about sides DE and EF?

    A.Side EF has a length of 6 units and is longer than side DE. B.Side DE has a length of 7 units and is longer than side EF. C.Side EF

  75. compare the process of digesting food in an amoeba (unicellular) to those in a mouse (multicellular),

  76. The functions f and g are defined as follows. f(x) = -x + 2

    g(x) = x^2 - 1 The point (b,c) is on both the graph of f and the graph of g in the xy-plane. Which of the following inequalities must be true?

  77. Use the Charles Graham image of workers in Pittsburgh to answer the question. Which of the following products of the nineteenth century was NOT an effect of the type of production shown in the image?

    A. railways B. skyscrapers C. organized labor D. western

  78. Use the photograph of immigrants at the Ford Motor Co. Factory in Detroit to answer the question. How does this image illustrate a domestic response to immigration?

    A. It shows that native-born Americans largely resisted increasing immigration. B. It shows

  79. Which resource can be used up, but is considered renewable because it can replace itself?(1 point)

    Responses trees trees wind wind copper copper geothermal

  80. The quadratic function f is graphed in the xy-plane shown. The function will be transformed to form a second function, g. For which transformation of f will the equation f(x) = g(x) have two solutions?

  81. Draw each figure.

    AD←→

  82. The graphs below show energy usage and sources in the U.S. .Using the graphs, which of the following is true?

    A. 37% of energy usage is due to transportation. B. Nonrenewable resources make up about 93% of the sources of energy. C. Hydroelectricity makes up

  83. What can develop when the temperature of the ocean is 80°F.

    A. Tornado B. Tsunami C. Thunder Storm D. Hurricane

  84. The city council of Centerville pass a law requiring all new buildings to be outfitted with low-flow toilets instead of regular toilets. The low-flow toilets use approximately 2 less gallons of water per flush. What will be the most likely effect of this

  85. Aluminum is produced from bauxite ore and can be used for many things. Which option describes a common production use of aluminum?(1 point)

    Responses electrical wiring and pipes electrical wiring and pipes steel objects steel objects lightweight containers

  86. Which atmospheric layer contains weather?

    A. mesosphere B. stratosphere C. thermosphere D. troposphere

  87. hich expression is equivalent to 54n-20m+6n?

    A. 40mn   B. 60n+20m   C. 20(m-3n)   D. 20(3n-m)

  88. rust on an artifact is an example of

    A. chemical decomposition B. chemical preservation C.physical decomposition D.physical preservation

  89. The number line below shows v, the amount of money Mandy needs to buy a new volleyball.

    A number line between 0 and 30 in increments of 10. A bold line start with a closed circle and heading rightwards. Which inequality represents the values of v that are

  90. How can the main idea of a text help a reader identify the theme?

  91. f

    ( x ) = 3 x − 7 and g ( x ) = − 2 x − 6 . Find ( f ∘ g ) ( 4 ) .

  92. What does it mean to use a critical stance

  93. Degree of freedom

  94. What connections do you need to figure out when you are critically thinking about your sources

  95. confidence interval

  96. Type II error

  97. Analysis of variance

  98. Explain difference approarches used in computing test statistics

  99. I Know Why the Caged Bird Sings figurative language.

  100. I Know Why the Caged Bird Sings figurative language example

  101. In what way does the organizational pattern used in paragraphs 5 through 7 help to develop the thesis?

    A. The classification of three learning styles shows that people can come to appreciate foods in a variety of ways. B. Different types of food are listed

  102. In I Know Why the Caged Bird Sings Describe the setting using figurative language

  103. 3. What is the assumption underlying the linear regression models

    i. Derive the least-squares estimates by any parameters of your choice ii. What is the Regression through the Origin ii. Derive the least-squares estimates of a regression model through the

  104. The author begins the selection with a leading question most likely

    TO - F. identify for the reader what problem will be answered in the selection G. help the reader relate a personal experience to the ideas presented in the selection H. force the reader to

  105. The author begins the selection with a leading question most likely

    TO - F. identify for the reader what problem will be answered in the selection G. help the reader relate a personal experience to the ideas presented in the selection H. force the reader to

  106. The author begins the selection with a leading question most likely

    TO - A. identify for the reader what problem will be answered in the selection B. help the reader relate a personal experience to the ideas presented in the selection C. force the reader to

  107. The author begins the selection with a leading question most likely

    A. identify for the reader what problem will be answered in the selection B. help the reader relate a personal experience to the ideas presented in the selection C. force the reader to

  108. The result of Cleary's experiment supports which idea about déjà vu?

    A. But this was proved untrue when a 2006 experiment at the University of Leeds, a world leader in déjà vu research, demonstrated that the blind also experience déjà vu. B. One early

  109. Which of the following are powers that the U.S. government holds because these powers have generally been held by national government?

    A. Enumerated powers B. Implied powers C. Inherited powers D. Prohibited powers

  110. Which of the following are powers that are exercised by both the national government and state governments at the same time?

    A. Concurrent powers B. Enumerated powers C. Prohibited powers D. Reserved powers

  111. Which type of government did the United States use before we ratified the constitution?

    A. Confederation B. Federal C. Parliamentary D. Unitary

  112. Which shows the power of unitary government?

    A. States have equal powers with each other. B. States have more power than the federal C. States can establish rules at cities have to follow. D. States can vote on the laws of the national government

  113. Which of the following can citizens legally do because of the full faith and credit clause in the constitution?

    A. Drive in a car in one state with a drivers license from another state B. Pay income taxes for a state where you don’t live in if their taxes

  114. Which of the following is an example of the committee clause?

    A. You can buy property in the state where you are not a resident. B. You can pay in state tuition, no matter what state you live in. C. You can refuse to follow laws in a state where you are

  115. Which is an exception a state is allowed to make to the committee clause

    A. Defensive of marriage B. Extradition. C. Privilege D. Reasonable discrimination.

  116. Which fertilize cleaning states did not have to pay national laws they believed were unconstitutional?

    A. Extradition laws. B. Mandate laws. C. Nullification laws. D. Traffic laws.

  117. Which was made by illegal by the sedation act?

    A. Making false statements about public officials. B. Making laws against the constitution. C. Play some traffic on foreign goods. D. Seceding from the union.

  118. Which of the following is an example of detentions traded by federalism that led to the Civil War?

    A. Can a state make its own property laws? B. Can I stay deny free-speech rights? C. Can I stay refuse to collect traffic? D. Can a state secede from the

  119. How old is the incorporation doctrine service to increase the power of the federal government

    A. It helps the federal government administer grants. B. I prevent states from restricting a citizens civil rights. C. It requires state to allow cities to make

  120. Which of the following to find centralization?

    A. The movement of the population to cities B. The increase in national power. C. The simplification of the lies. D. The preference for immigrants from Europe.

  121. Under the United States constitution which of the following is every state guaranteed

    A. A republican form of government. B. Elected Supreme Court judges. C. Fair income taxes. D. Two houses of Congress.

  122. The federal government must protect the states from which threat

    A. Domestic violence. B. Marriage equality. C. Unfair laws. D. Rational discrimination.

  123. How does a federalism create a certain amount of tension between the national government and state government?

    A. Both national and state governments share power. B. State and local governments have no support from the federal government. C. States are not

  124. Describe an argument that states rights advocates must use to make their case that the centralization is a bad thing. Include specific examples of centralization.

  125. Lesson 10 linear functions unit test

  126. Describe a situation in which a state governor might ask for a federal troops to be sent to his or her state. How would the situation been example of responsibilities that the federal government owes to the state

  127. enter your answer and show all the steps that you use to solve this problem in the space provided

    write (8a-^-3) ^-2/3

  128. Note: Enter your answer and show all the steps that you use to solve this problem in the space provided.

    What is the simplest form of the radical expression?√ 2 + √ 5 √ 2 − √ 5

  129. x+y=16

  130. x+y=16

    is y a function of x

  131. Does the equation x+y=16 define y as a function of x?

  132. Compare and Contrast Neolithic V.S. Paleolithic

    PLEASE PROVIDE EVIDENCE

  133. Neolithic V.S. Paleolithic

    compare and contrast

  134. Neolithic V.S. Paleolithic

  135. Neolithic V.S. Paleolithic Essay

  136. Does the equation x+y=25 define y as a function of x

  137. compare and contrast neolithic and paleolithic

  138. Which of the following is NOT a valid reason that less energy is transferred at each level of the food chain?

    A. Energy is released as heat energy during respiration B. Energy is destroyed because animals at higher levels do not need as much energy C.

  139. compare and contrast neolithic and paleolithic

    essay

  140. write an essay compare and contrast neolithic and paleolithic

  141. Does the equation x squared plus y equal 16 define y as a function of x?

  142. The suitors know they have no chance of surviving when

    O they realize the beggar is Odysseus returned. O Odysseus kills Antinous with his bow and arrow. O they see the shape of Athena's shield above the hall. O Telemachus arms Eumaeus and the cowherd.

  143. Sqrt 2x+10 -6=2

    What is the answer

  144. How is the level of entropy in the universe impacted as energy moves through a food chain?

  145. F(x)=-2x+4 and g(x) =-6x-7 find f(x) -g(x)

    I need the answer

  146. What is the inverse of the given relation

    Y=3x+12

  147. Rewrite 3 sqrt 27x-81 -5 to make it easy to graph using a translation

  148. Does the equation x^2+y=25 define y as a function of x?

  149. F(x) =3x-7 and g(x)=-2x-6 (f o g) (4)

  150. x^2+y=16

  151. In which of the following expressions does the “x” term have a coefficient of 1?

  152. As researchers cool a substance close to absolute zero, what happens?

    A) The work needed to cool it further decreases, becoming easier. B) The work needed to cool it further increases. C) Work is done on the environment by the substance. D) The work needed

  153. In which of the following expressions does the “X” term have a coefficient of 1?

    x^2 +2x +7 3x^2 - x - 5 2x^2 - 3x + 1 2x^2 + x - 9

  154. Does the equation x^2+y^2=16 define y as a function of x?

  155. Jillian simplified the expression 7 + 3 • (10 - 6)^2 in the following way:

    7+3•(10 - 6)^2 7+3 • (4)^2 7+3 • 16 10• 16 160 What was the error Jillian should have added 7 + 3 in line 2 before doing (10 - 6)^2 There is no error, Jillian simplified

  156. What is the difference between Pareto optimality and parento efficient?

  157. What is Pareto inefficiency?

  158. Pareto improvement

  159. Please anyone to assist about this problem

    By using hyperbolic substitution integrate sqrt (9 - x^2)

  160. The way you communicate with others how you say things and what you say plays a role in how messages are received by the other person. Which type of communication uses gestures and tone of voice that can seem threatening to other other persons?

  161. A group of 6 students is discussing a plan to organize a school fundraiser. All of the students in the group want to participate but once student is chosen as the lead organizer to help make sure the plan runs smoothly. 5 students think the group should

  162. How can character development impact plot development?

  163. ANOVA

  164. the student arrived on time, ........................? a)didnt they b)did they c)do they

  165. Approaches of test statistics

  166. Which inverse operation would you use to solve the equation 8X + 5 = 21

  167. A(n) blank is a number that represents an unknown quality

  168. I will use inverse operations to slove this qu.what should be the first to solve 32/x=4?

  169. X=3 solve (2×+8)

  170. Federal judges are appointed by the president of the United States how are judges in Georgia state court selected

  171. Which statement best describes how the grand jury protects individual citizens from abuse of power by elective officers

  172. What is the value of me if -7+ B = -8

  173. What is the solution to 5q = -75

  174. What is the solution to r/-3=12

  175. What is the solution to -7+h=12

  176. What is the solution to 1+(-3) =9

  177. A sculptor creates a bust of a famous politician out of marble and places it in the outdoor courtyard of the capitol building. Why did he choose marble?

    • He wanted to honor the politician by using an expensive material. • Marble is cheap and easy to

  178. If a firm had everywhere increasing returns to scale, what would happen

    to its profits if prices remained fixed and if it doubled its scale of operation?

  179. Which of the following statements best describes the Galveston hurricane?

    • Advance warning of the storm led many people to evacuate the island. • Although it was very costly, loss of life was minimal. • It was considered the deadliest natural

  180. What was the main motivation for the early Populists?

    • competition from railroads for land • low crop prices and lack of government aid • the need to expand the market for their crops • the new farmers' labor union

  181. The following regression equation for quantity supplied was estimatedusing a sample of fifty observations.

    Q = 2.2 + 0.104P. (3.4) (0.005) Standard errors are in the brackets. The total sum of squares was 132 and the residual sum of squares was 19.5

  182. What was the Progressives’ solution to the problem of alcohol abuse?

    • They built treatment centers. • They voted for more funding for treatment centers. • They supported funding for counseling. • They supported Prohibition.

  183. If a firm had decreasing returns to scale at all levels of output and it

    divided up into two equal-size smaller firms, what would happen to its overall profits?

  184. In what ways was the new government in Galveston successful?

    • It created neighborhood parks for citizens to use. • The commissioners created a sense of community pride. • The commissioners were given government grants. • The infrastructure of the

  185. 8. The following regression equation for quantity supplied was estimatedusing a

    sample of fifty observations. Q = 2.2 + 0.104P. (3.4) (0.005) Standard errors are in the brackets. The total sum of squares was 132 and the residual sum of squares was 19.5 i.

  186. Is maximizing a firm's profits always identical to maximizing the firm's stock market value?

  187. How many postive intergers less than 4000 with no repeated digits can be formed where each digit is either 2,3,4,5 or 6?

    The answer is 133 however i do not understand the working out at all..

  188. If pMPl > wl, then should the firm increase or decrease the amount of

    factor 1 in order to increase profits?

  189. Which of the following is the best strategy for studying for a test?

    • sitting alone in a chair in a quiet room, looking over your textbook • working in pairs and exchanging practice questions • developing a personal method that is right for you and

  190. Given indirect utility function of the nature V(P, M)=M²/4P1P2.

    a) derive the ordinary demand function b)Derive associated expenditure function

  191. Given indirect utility function of the nature V(P, M)=M²/4P1P2.

    a) derive the ordinary demand function b)Derive associated expenditure function. Show your working clearly

  192. What does explicit mean?

    • information that is understood from context • information that is stated directly • information that is somewhat vague • information that is inferred

  193. A fishing project owned by Sanga family has its investment costs spread over from year 0 -3 as follows;

    Tsh. 5 million, Tshs. 2 million, Tshs. 1.5 million and Tshs. 1.0 million respectively. Sanga family expects to start fishing in year 4 to year 12 where

  194. A fishing project owned by Sanga family has its investment costs spread over from year 0 -3 as follows;

    Tsh. 5 million, Tshs. 2 million, Tshs. 1.5 million and Tshs. 1.0 million respectively. Sanga family expects to start fishing in year 4 to year 12 where

  195. A monopolist's demand fQuestion 1.

    unction is given as Y=2000-10K, where Y is the quantity of output produced and sold and K is the price per unit in Tshs. If the marginal cost is Tshs 100 Show the inefficiency caused by the above monopolist

  196. what is the largest word in english

  197. Define undercapitalizaton causes, effects and remedies

  198. Causes of undercapitalizaton

  199. Remedies of undercapitalizaton

  200. Which of the following is not required of Georgia state senators?

    A. must be 25 years old B. must be a legal resident of Georgia C. must have a college degree D. must have U.S. citizenship

  201. Which is true of bills to raise or spend money?

    A. They must be vetoed by the Senate. B. They must originate in the House. C. They must be presented in a public hearing. D. They must be passed “as is.”

  202. How is it possible to override the governor’s veto?

    A. A two-thirds majority in each house must vote to override the governor’s veto. B. Each house must unanimously vote to override the governor’s veto. C. At least one house must unanimously vote to

  203. 1(Which type of surface would best reflect light?

    smooth and shiny) 2(Which statement best describes the reflection of a wave? A wave bounces off the surface of a material.) 3(How is an echo formed? Sound waves bounce off a flat surface.) 4 (The surface of

  204. While looking at some reports, a store manager notes that treadmills that retail for $400 end up costing customers $408 once the sales tax is added. What is the sales tax percentage?

  205. How is the size of a legislative district determined?

    A. by geographical boundaries B. by city limits C. by the apportioned population D. by county boundaries

  206. What is the most important duty of members of the Georgia General Assembly?

    A. appointing members to committees B. voting on proposed laws C. listening to interest groups D. campaigning for re-election

  207. The term bicameral legislature refers to two of what?

    A. chambers of the General Assembly B. state senators in the federal government C. legislative sessions per year D. lawmakers required to introduce a bill

  208. Isabella rings up an item that costs $47. After sales tax, the total is $49.35. What is the sales tax percentage?

  209. Who would step in as leader of the state Senate if the lieutenant governor had to assume the role of governor?

    A. speaker pro tempore B. majority caucus chair C. president pro tempore D. No one; the Senate wouldn't change the leadership.

  210. The 3rd term of an ap is 15 and the 15th term is 21 find the common difference first term and the sum of the first ten te

  211. 5×g=230

  212. 5×g=230

    explain

  213. z÷12=9

    explain

  214. Which of the following represents a unit rate

    A) $4/12 books B) 5 pages/ 2 minutes C) 80 beats/1 minute D) 72 inches/ 2 yards

  215. how many miles can a car travel on 15 gallons of gas if it travels 28 miles on 1 gallon of gas

  216. Samantha types 40 words per minute. how many words can Samantha type in 8 minutes

  217. select all that form a proportion

    A) 1/6,4/20 B) 7/9,28/36 C)14/18,21/27 D) 30/80,6/18

  218. which ones do not form a proportion

    A) 3/5,24/40 B) 30/10,15/5 C) 9/14,3/4 D) 7/12,14/24

  219. for which value of m is 4/16=m/24

    1)6 2) 8 3)12 4)14

  220. Solve

    t/16=40/50

  221. Which factor contributed to the lack of stability and freedom in Afghanistan?

  222. you are spending time with one of your best friends at a local batting cage. you are both working on your swing to improve your hit percentage. a friend of your friends comes up to you and offers you a cigarette. your friend accepts, starts smoking, and

  223. you are spending time with one of your best frinds at a local batting cage. you are both working on your swing to improve your hit percentage. a friend of your friends comes up to you and offers you a cigarette. your friend accepts, starts smokinging, and

  224. A ringing alarm clock is put under a glass jar. The air is slowly removed from the space around it. What will happen as the air is removed?

    A.) The appearance of the clock will not change, but its sound will become fainter. B.) The appearance of the clock

  225. 5xg=230

  226. How are mechanical waves defined?

    A.) They are waves that are able to pass through a vacuum. B.) They are waves that require some form of matter as a medium. C.) They are waves that involve matter, rather than energy, moving from one place to another. D.)

  227. Where do sound waves travel faster?

    A.) through denser materials, because the molecules in a tightly packed medium collide more frequently B.) through less dense materials, because the molecules in a loosely packed medium collide less frequently C.) through

  228. The retina of the eye has rods and cones which play a crucial function in sight. Which statement explains how rods and cones work to help us see things?

    A.) Cones detect light; rods detect color; and the brain decomposes the color into green, blue, and red.

  229. The American flag flies on a black flagpole. Light from the sun hits the flag and the flagpole. How is it that you can see the blue, red, and white colors of the flag and the black of the flagpole?

    A.) Red stripes reflect red and absorb all other light, as

  230. What is Sanskrit?

  231. How much it cost the Two xtike Doll from Peru at The Walter Art Museum, Baltimore?

  232. How much it cost the Textile Doll from Peru at The Walter Art Museum, Baltimore?

  233. What is the value of the Textile Doll from Peru at The Walter Art Museum, Baltimore?

  234. What is the value of the Pectoral Egyptian at The Walter Art Museum, Baltimore?

  235. comparison: which one has more value the Pectoral Egyptian or the Textile Doll of Peru

  236. Similarities: on the Pectoral Egyptian and the Oval Box with Monogram of Nicholas 2 Russia?

  237. 87390 rounded off to the nearest 10

  238. How are the Pectoral Egyptian and the Oval Box with Monogram of Nicholas 2 Russia the works different?

  239. A clock is slow by 300s in 1 week. How many seconds wil it lose in 14 days?

  240. This broach contains a miniature picture of America statesman Henry Clay. Likely owned by Clay or his ancestors, this broach is valued for what reason?

  241. Is society adequately preparing for the physical and mental wellness of the elderly? Does the concept of an integrated approach to health care for the growing older adult population appear to be a viable solution?

  242. Which of these is a solution to the equation?

    2\left(x-5\right) =9-3x+6+8+3x+7 Responses x=10 x-20 x=40 x=80

  243. Multiply 3/16 times 4 and write the answer in simplest form. (1 point)

    Responses

  244. Write a list of steps that I need to find the measure of <b

  245. Examine the diagram, and answer the question The diagram shows A ( -3,5) and B(8,1) what is the distance between the points Enter your answer as a number, withut units round your answer to one decimal place if necessary like this 42.6

  246. Find the missing angle measure then classify the triangle by its angles

  247. Angle find the missing angle measure then classify the triangle by its angles

  248. Classify each triangle by its sides

  249. Find the area of the given circle. Round to the nearest tenth

  250. What is the linkage between the existing Tanzania industrialization policy and the five year Development plan

  251. Which of the following statements best describes the Galveston hurricane

  252. Which of the following is most important in the interpretation of an allusion?

    A. The level of meaning. B. Understanding the reference. C. Communicating effectively. D. The attention of the reader.

  253. Which sentence includes an allusion

    A. Mary decided to write an adaption of the story of Goldilocks for her writing assignment B. Feeling like Superman, Josée, a race around the track at a speed he did not think he was capable of before today. C. Thomas

  254. Which connection must be made to interpret in allusion

    A. A connection between what is implied in what is referred to in the text. B. A personal connection between the author and the reference subject matter. C. A personal connection between the reader and

  255. Why might an author use an allusion in writing?

    A. To add a figure of speech. B. To make the reading more personal. C. To make the reading more difficult. D. To add layers of meaning.

  256. How does the central idea of the story differ from its theme?

  257. Which of the following is the best description of the difference between the theme and central idea of a story

  258. A student is saving money in a bank account to buy a computer. The function f (w) = 35w + 10 represents the total amount of money, f , in dollars, in the student's account w weeks after the student started saving for the computer.

  259. A student is saving money in a bank account to buy a computer. The function f (w) = 35w + 10 represents the total amount of money, f , in dollars, in the student's account w weeks after the student started saving for the computer. What does the number 10

  260. Which equation can be used to find the measure of an angle that is supplemntary toEOF

  261. Finance mean.

  262. if 1/2 is added to three times the reciprocal of a number, the result is 1, what is the number?

  263. Nullification mean.

  264. what is the domain for the sqaure root of 5x-2?

  265. Identify the six parts of Hamilton’s Financial Plan.

    a. b. c. d. e. f.

  266. What issue led to the creation of the first American political parties?

    Give answer in 8th grade explaination.

  267. These are the answers for the "Rocks and Minerals" quick check.

    1.) Yes, rocks are valuable because they are useful to people. 2.) Lightweight containers and drugs 3.) Glass manufactoring and paints 4.) Copper conducts electricity well so it can be used for

  268. Which of the following would be the correct most simplified version of:

    (27x^-3)^-4/3 A) x^4/27 B) -81x^4 C) 3x^4** D) x^4/81 Need help pls!

  269. Bob is buying the soccer team snacks after their game today. 8 players want cookies and 5 players want ice cream. If ice cream cost $1.25 each and cookies cost $1.75 each, how much will Bob spend on snacks for the team?

    A. $16.25 B. $18.75 C. $20.25 D.

  270. What is a mnemonic device?

    A: a tool used to aid in hearing B: a tool used to aid in memory C: a tool used to aid in designing text D: a tool used to write sentences

  271. It takes Kendrick 20 minutes to travel 5 miles to school on his bicycle. Which correctly shows the relationship between the distance Kendrick travels and time?

    A. y = 15x B. y = 4x C. y = 0.25x D. y = 1.25x

  272. Incomplete dominance is when neither allele is dominant. A third phenotype (physical characteristic, what it looks like) is produced. For example, a red flower (RR) and a white flower (rr) produce a pink flower (Rr). Which of the following is an example of

  273. Which of the following is an acronym?

    A: RAM B: Every Good Boy Does Fine C: association D: mnemonic device

  274. Joseph buys a gallon of milk every 6th day and a box of cereal every 8th day. He bought both items today. In how many days will he buy both items together again?

    A. 14 B. 18 C. 32 D. 24

  275. Which of the following is an acrostic?

    A: RAM B: association C: mnemonic device D: Please Excuse My Dear Aunt Sally

  276. which of the following best describes association as a memory technique?

    A: only acrostics and acronyms B: connections between something familiar and concepts you need to remember C: an organization that teaches memory strategies D: a sentence containing a

  277. The quadratic relationships, J and K, are represented in the following table and graph, respectively. Which of the following statements about the relationships are true?

  278. The temperature at 5:30 a.m. was –4° Fahrenheit (F). Eight hours later, at 2:30 p.m., the temperature is the opposite of –4 °F.

    The number line shows numbers from negative 8 to 8 in intervals of 1. The point A on negative 8, the point B is on negative

  279. Hello remember me program?

  280. Draw a teardrop angel.

  281. Michael used a stopwatch to time the baseball pitches for three of his friends. The times are listed in the table.

    The table shows pitching times in seconds. Pete pitched in 0.537 seconds, Ivan pitched in 0.58 seconds, and KaShawn pitched in 0.4996 seconds.

  282. The expression 2x + (x - 7)^2 is equivalent to x^2 + bx + 49 for all values of x. What is the value of b?

  283. It’s been like a month almost

  284. Why did you randomly stop answering me?

  285. Sara and Tina are scuba diving. Sara is at –75 feet and Tina is at –125 feet. Which statement is true about Sara and Tina?

    A. Tina is diving deeper than Sara because |–125| is greater than |–75|. B. Tina is closer to the surface than Sara because

  286. But your a program how do you get distracted

  287. Louisa, Kristen, and Javier live in the same neighborhood. They created a map showing the locations of their houses on the coordinate plane below. Louisa's house is located at , Kristin's house is located at , and Javier's house is located at . On Saturday

  288. Read the subject

  289. Triangle has vertices of , and . Which of these statements is true about sides and ?

    A. Side EF has a length of 6 units and is longer than side DE. B. Side DE has a length of 7 units and is longer than side EF. C. Side EF has a length of 8 units and is

  290. Bye bye program

  291. Ashley and Kendall are both downloading a large file online. Below are the numbers of seconds each has been downloading and the number of megabits downloaded. Which of these statements is true based on the given information?

    Ashley: Number of Seconds 2 4 8

  292. Alicia has a piece of yarn that is 4.7 meters long. Rick has a piece of yarn two and a half times as long as Alicia’s. How long is Rick’s yarn?

  293. Amelia used a $50 gift card to buy digital music online. After paying for 16 songs, her balance on the gift card was $30. What was the price of each song, assuming all songs cost the same amount?

    A. $3.13 B. $1.87 C. $1.25 D. $1.00

  294. What myths have you learned in School?

  295. What is a main idea

  296. Katie's swim team is having an end-of-season pizza party. When the party started, there were 50 slices of pizza. Now there are 20 slices left. Which of the following shows how much of the pizza has been eaten?

    A. B. C. D.

  297. How can the main idea of a text help a reader identify the theme

  298. what is the domain of:

    the square root of 5x-2

  299. Mrs. Fairfax went to the grocery store to buy groceries for dinner. She had to buy two loafs of bread for $1.89 each, three pounts of ground beef for $5.69 per pound and cheese for $2.99. She gave the cashier a $50 bill. How much change did she get back?

  300. Fossil Fuels and Climate Change Quick Check i need all answers please

  301. A sequence is defined by a^n = -5 + (n - 1)14, where n is a positive integer. What is the value of a^10?

  302. Katie's swim team is having an end-of-season pizza party. When the party started, there were 50 slices of pizza. Now there are 20 slices left. Which of the following shows how much of the pizza has been eaten?

    A. 20/50 B. 60% C. 40% D. 40/100

  303. Identify a counterclaim for the following argument.

    Driving electric or hybrid cars is the best way to cut down on air pollution. (1 point) Responses Gas-powered cars are the largest private source of air pollution. Gas-powered cars are the largest private

  304. Shannon is planning a surprise birthday party. She has to rent tables and chairs, and each table costs $35.00 and each chair costs $6.00. If the other costs of the party are $315.00, which of the following expressions represents the total cost of the

  305. Consider the equation (x - a)^2 - b = 0, where a and b are both positive real numbers. Which statement about the solution or solutions to the equation must be true?

  306. What is the best definition of the term satire

  307. Why did many 19th century artists create pieces that aligned with the views of their government

  308. What dose the term polyphony mean

  309. What is the primary role of activist art

  310. Reading and Interpreting Primary Sources

  311. In which case would the kinetic energy of particles be increasing? (1 point)

    Responses Metal is heated from room temperature to 200°C. Metal is cooled at 1,300°C. Metal is melted at 1,300°C. Metal is at room temperature, 37°C.

  312. Water boils at 100°C and turns into steam. Which similarities or differences are there between water at 100°C and steam at 100°C? (1 point)

    Responses The particles will have more space between them and will be moving at higher speeds as steam. The

  313. Reading and Interpreting Primary Sources quick check

  314. help with all answers for Fossil Fuels and Climate Change Quick Check

  315. What happens to air pressure and the amount of oxygen as the altitude increases in Earth's atmosphere

  316. which term as it relate to the internet means to act in an unthinking unsafe or disrespect manner online

  317. In one or two sentences, explain why the combined weight of several liquids mixed in an open flask can be less than but never more than the sum of all the weights of the ingredients.

  318. Which describes the important role of the ozone layer

  319. How did the industrial revolution contribute to the global climate change

  320. Which action would help reduce global warming

  321. An office manager is ordering this year's supply of pencils and pensbfor the office. Each pencil costs 0.10$, each pen costs $0.75, and the manager will spend a total of $235 on pencils and pens. Which additional piece of information is sufficient to

  322. What is the main reason why raising cattle contributes to global warming

  323. Why do scientists believe that Winters might be milder on the Eastern seaboard in the future

  324. For the equation y = 5 + 6x, what does y equal when x is 4?

    A. 29 B. 15 C. 19 D. 23

  325. Marianne has decided to track the number of books she reads to her little sister. The relationship between the weeks, w, and the total number of books that have been read, b, is shown in the table below.

    Number of weeks Number of Books 0 2 1 6 2 10 3 14 4

  326. what will be the outcome of deletion of the third base, A from the DNA sequence below? assume that the first base corresponds to the start of a codon

  327. in the sentence, what does the suffix in the word ravenous mean

  328. The system of equations shown is graphed in the xy-plane. X + y = 1

    2x - 3y = 17. Determine the coordinates of the solutions of the system algebraically. Then show that your solution is valid. Show your work or explain how you found your answer.

  329. A store sells packages of pencils. Which package offers the best unit price? 12 pencils for $3.36 12 pencils for $3.36 15 pencils for $4.05 15 pencils for $4.05 16 pencils for $4.16 16 pencils for $4.16 13 pencils for $3.25 13 pencils for $3.25

  330. Why do mid latitude cyclone dissipate?

  331. A student evaluates the expressions and at several different values of . The student claims, "The value of the expression is always greater than the value of the expression ."

    Which value of can be used to show that the student's claim is false? A. 2 B. 4

  332. what type of mutation occured in the following example? original DNA: CAT GAT new DNA: CAT AT

  333. Why do mid latitude cyclone occur in families all year round ?

  334. Victor cut four congruent triangles off the corners of a rectangle to make a hexagon, as shown below.

    A rectangle that is 28 c-m long and 16 c-m wide has right triangles cut out from all four corners each with height and base length of 8 c-m. What is the

  335. In one or two sentences explain how the loss of Arctic sea ice may affect the ocean currents and climate near the Western European Coast

  336. in the sentence, what does the suffix in the word patriotism mean?

  337. Why do mid latitude cyclone move from west to east ?

  338. right triangle is removed from a rectangle as shown in the figure below.

    A right triangle of height 9 m-m is removed from the rectangle of length 18 m-m and width 15 m-m. The length to the left of the removed triangle is 3 m-m and to the right is 9 m-m.

  339. right triangle is removed from a rectangle as shown in the figure below.

    A right triangle of height 9 m-m is removed from the rectangle of length 18 m-m and width 15 m-m. The length to the left of the removed triangle is 3 m-m and to the right is 9 m-m.

  340. find the surface area of a sphere with the radius of 8 cm

  341. average is the opposite of which of the following

    abnormal moderate ordinary typical

  342. choose the word that means to give special attention to something or make important

  343. Talulah drew the net shown on a piece of cardboard. She plans to cut it out to make an odd-shaped gift box.

    The pattern has three rectangles side by side. The shorter side of the rectangles is 3 c-m, the lengths of rectangles are 4 c-m, 3 c-m, and 5 c-m

  344. Which of the following conclusions is supported by the chart ?

    Average time spent on math homework by student grade level shows minutes per night from 10 to 30 in increments of 5 on the vertical axis and grades 5, 6, 7, 8 on the horizontal axis with a bar

  345. The table below shows how many minutes Mary spent exercising each day for the last two weeks.

    Mary's Time Spent Exercising Sun Mon Tue Wed Thu Fri Sat Week 1 0 min 45 min 45 min 40 min 50 min 35 min 0 min Week 2 0 min 45 min 50 min 45 min 40 min 50 min 35

  346. whenever mark went swimming in the ocean, he was amazed by the great___ of the seemingly never-ending water. he felt so small compared to the ___ of the ocean.

  347. Which graph shows data that are clustered about the center, with no outliers?

    A. The line plot shows numbers from 0 to 10 in increments of 1 has one X above all the numbers. B. The line plot shows numbers from 0 to 10 in increments of 1. There is one X

  348. choose the word that has the same meaning as yearn

  349. On a coordinate graph, the points and are the vertices of a square. What is the area of the square?

    A. 7 square units B. 14 square units C. 28 square units D. 49 square units

  350. Everybody loves a sale! The Johnson family has been waiting for a sale to buy a trampoline. Sports King is having a sale and all items are 20% off. How much will the Johnson family save on a $300 trampoline?

  351. 1.

    Robin wants to make a list of all of the software on a laptop. Which of the following should be left off of the list?

  352. How do anthropologists learn about prehistoric humans?

  353. How were the early civilizations of the Nile, Tigris and Euphrates, and Yellow Rivers similar to one another?

  354. Calculate how much Susan will actually pay back after 60 months excluding the interest

  355. How do anthropologists learn about prehistoric humans?

    How were the early civilizations of the Nile, Tigris and Euphrates, and Yellow Rivers similar to one another? What about Judaism appealed to its followers? Contrast the Mayan and Aztec Civilizations.

  356. Which statement about bonding is correct?(1 point)

  357. Which of the following happens when an ionic bond is formed?(1 point)

    Responses One atom pulls an electron from another atom. One atom becomes more electronegative than another atom. Two atoms share an electron. Two atoms attain equal electronegativities.

  358. Which of the following happens when an ionic bond is formed?(1 point)

    Responses One atom pulls an electron from another atom. One atom pulls an electron from another atom. One atom becomes more electronegative than another atom. One atom becomes more

  359. Which statement about bonding is correct?(1 point)

    Responses Breaking bonds requires energy and is exothermic. Breaking bonds requires energy and is exothermic. Breaking bonds releases energy and is endothermic. Breaking bonds releases energy and is

  360. Fluorine is the most electronegative element on the periodic table, which means that, in an ionic bond, fluorine will always (1 point)

    Responses share electrons equally with other elements. share electrons equally with other elements. share electrons

  361. The bond energy between carbon and oxygen is 358 for a single bond (C–O) and 745 for a double bond (C=O). Why is the bond energy higher for double-bonded carbon and oxygen (C=O)?(1 point)

    Responses Additional bonds require more energy to break, so the

  362. Show how the balance payment value R733 760.42 for month 1 was calculated

  363. The bond energy between carbon and oxygen is 358 for a single bond (C–O) and 745 for a double bond (C=O). Why is the bond energy higher for double-bonded carbon and oxygen (C=O)?(1 point)

    Responses Additional bonds require more energy to break, so the

  364. Forming Bonds Quick Check

    5 of 55 of 5 Items Question Use the bond energies to answer the question. H–H = 432 H–O = 467 O–O = 146 O=O = 495 H2 (H–H) combines with O2 (O=O) to become hydrogen peroxide (H2O2) bonded as such: H–O–O–H. Which

  365. Does anyone have the answers to the Atmosphere Unit Test?

    I really need help, so pleaseeeee

  366. Which property is illustrated by the statement? (4+6.1) + 7 = 4+ (6.1+7)

    1. Associative property of addition 2. Inverse property of multiplication 3. Commutative property of addition 4. Inverse property of addition If you have the whole test please help out

  367. Show how the closing balance after payment value R719 512.34 for10 months was calculated

  368. Show how R725 000.00 after payment value R719 512.34 for 10 months was calculated

  369. Which property is illustrated by the statement? (4+6.1) + 7 = 4+ (6.1+7)

  370. true or false the ecological perspective is concerned with the human elements of location

  371. The bank charges interest 14.5% per year on Kate's home loan

    If the bank charges interest ever month , calculate the monthly interest rate. If necessary,round off your answer to six decimal places

  372. I'd say probably Richie, he's hilarious, my 2nd fav would be Beverly, BEV STANS RISE

  373. choose the word that has the same meaning as gloomy

  374. Show how the interest value R8 760.42 for 1 month was calculated

  375. True or False :

    The ecological perspective is concerned with the human elements of locations . Society is defined as social relations and groups formed by humans within a specific geographic area Meteorology is the science of predicting the weather An

  376. The life of Kate's loan is 20 years and the interest rate on the loan is 14.5% per year. Use the formula and factor table below how monthly repayment value of R9 280.00 was calculated

  377. If a cell measures 10 mm when magnified by 100, what is the cell's actual size?

  378. true or false

    Society is defined as social relations and groups formed by humans within a specific geographic area

  379. The life of Kate's loan is 20 years and the interest rate on the loan is 14.5% per year. Use the formula and factor table below how monthly repayment value of R9 280.00 was calculated

  380. submissive is most similar in meaning to ___

  381. true or false

  382. true or false Meteorology is the science of predicting the weather

  383. true or false An increase in pay is an example of a push factor

  384. Calculate the total amount that Kate will pay in interest on the loan during this two years period

  385. Find the area of the given circle. round to the nearest tenth.

    22.0cm (squared) 38.5cm (squared) 11.0cm (squared) 42.8cm (squared)

  386. Calculate the total amount that Kate will pay to the bank during this two years period

  387. Find the sum of the interior angles of a nonagon.

  388. What happens to air pressure and the amount of oxygen as the altitude increases in Earth’s atmosphere?

  389. What did Germans utilize to sneak attack enemy ships and wage unrestricted warfare?

  390. All of the following are part of President Wilson's "Fourteen Points," except

  391. The family tree below shows the trait of having attached earlobes. Having attached earlobes is recessive, and having detached earlobes is dominant. People with attached earlobes are shaded in.

    Describe the sex and characteristics of the person labeled a

  392. If an ankle is 50° greater than its calm plant, what is a measurement of the complement

  393. Describe the process by which cells produce the fgf5 protein from mature mRNA and include the location of the newly-formed protein

  394. Show how the balance before payment value of R733760.42 for month 1 was calculated

  395. This 1911 tragedy highlighted unsafe conditions in the workplace, claimed the lives of 146 people (mostly young women), and marked a turning point in the labor movement:

  396. Enacting consumer protection laws like the Pure Food and Drug Act

    Regulating big business through trustbusting Prohibiting the sale and use of alcohol in support of the Temperance Movement Conserving natural resources and creating national parks

  397. What does the term annex mean?

  398. What is the use of power for personal gain known as

  399. Which of the following is an example of a push factor for immigration?

    Owning land Education opportunities Religious freedom Political persecution

  400. Circles quick check

  401. Show how the closing balance after payment value of R719512.34 for month 10 was calculated

  402. Anemone

    I need help with the name please

  403. A political & social movement intended to address problems caused by urbanization & industrialization was ___.

    Socialism Progressivism Nationalism Populism

  404. A political & social movement intended to address problems caused by urbanization & industrialization was ___.

  405. I need help with the names of this organism

  406. Which of the following muckrakers wrote The Jungle?

    Ida Tarbell Upton Sinclair Eugene Debs Lincoln Steffen

  407. I need help with the names of all the organisms

  408. What political party was founded by former President Teddy Roosevelt in order to challenge President Taft in the election of 1912?

  409. What idea did Booker T. Washington present in his Atlanta Compromise speech?

    Encouraged black nationalism and cultural pride Called for an end to all forms of racial discrimination and disenfranchisement Suggested that African Americans focus on economic

  410. The bank charges interest at a rate of 14,5% per year on Kate's home loan.

    If the bank charges interest every month, calculate the monthly interest rate

  411. Use the electoral map and table to analyze the Election of 1912. Please explain the following:

    - Who won and what party were they from? - Describe the outcome, mentioning both the electoral votes and popular votes - Mentioning Theodore (Teddy) Roosevelt,

  412. What are the names of this i really dont know

    What are the names of this i really dont know - 1

  413. Show how the interest value of R8760.42 for month 1 was calculated

  414. What form of election involves members of a political party voting directly on candidates before the general election?

    Recall Initiative Referendum Direct primary

  415. Whats a vulva anyone know

  416. Write 2 out of the 5 reasons that SOCIETIES create art

  417. I need more detail on what it is (where is it located, what it does and when its needed)

  418. BONUS: ATGCCCCCGAGAAGCCCTTAG

    In the space below, provide the following: 1.) Replicated DNA strand 2.) Transcribed RNA strand 3.) Translated RNA strand (should be a silly but coherent sentence)

  419. Rhythm is the visual tempo or beat created by the placement of repeated elements within the work true or false

  420. Rust on an artifact is an example of

    A. Chemical decomposition B. Chemical preservation C. Physical decomposition D. Physical preservation

  421. 321 409 to the nereast 1000 and 100 000

  422. What was the accidental natural preservative for artifacts from the town of Pompeii?

    A. Acid neutral paper B. UV rays C. volcanic ash D. Water submersion

  423. Without​ graphing, determine whether the function represents exponential growth or exponential decay. Then find the​ y-intercept.

    ​f(x) = 4(0.62)^x

  424. UNIT 1

    Geometry LESSON 5 Polygons and Angles

  425. A spherical water tank holds 10500 ft of water. What is the diameter of the​ tank? (Hint: V= pi/6 times d^3

    ​)

  426. Without​ graphing, determine whether the function represents exponential growth or exponential decay. Then find the​ y-intercept.

    ​f(x) = 2^-x

  427. Suppose you deposit ​$2,000 in a savings account that pays interest at an annual rate of 6​%. If no money is added or withdrawn from the​ account, answer the following questions.

    a. How much will be in the account after 4 ​years? b. How much will be

  428. The following regression equation for quantity supplied was estimatedusing a

    sample of fifty observations. Q = 2.2 + 0.104P. (3.4) (0.005) Standard errors are in the brackets. The total sum of squares was 132 and the residual sum of squares was 19.5 i.

  429. A narrator who is not part of the story and only knows particular portion of thoughts and feelings is

    does anybody have the English 9 exam answers ?!

  430. For the given annual rate of​ change, find the corresponding growth or decay factor.

    +200%

  431. Find the value of the logarithmic expression.

    log2 32

  432. Thefollowingregressionequationforquantitysuppliedwasestimatedusinga

    sampleoffifty observations. Standard errors are in the brackets. The total sum of squares was 132 and theresidual ii.Testthehypothesisthatslopecoefficient(ß1)=0fallswithinthisinterval. Can

  433. You will be writing a short essay for your final product. In order to evaluate whether the Mexican-American War was justified, you need to consider the perspective of each side. In establishing the perspective of each side, you will need to use the

  434. What is the total cost of a 65$ meal with 8% sales tax and a 15% tip

  435. Expand the logarithm. Simplify if possible.

    log8 a/b

  436. Solve the equation.

    25^2x+1 = 36

  437. Suppose that a new employee starts working at ​$7.05 per hour and receives a ​5% raise each year. After time​ t, in​ years, his hourly wage is given by the equation y = $7.05(1.05)^t Find the amount of time after which he will be earning​ $10.00

  438. A student connects a battery to a wire and wraps the wire around an iron nail to produce an electromagnet. Which action should the student take to increase the number of paper clips the electromagnet can pick up?(1 point)

  439. According to Myplate, food groups should make up half of your plate?

    A. Grains and fruit B. Fruits and vegetables C. Vegetables and protein D. Protein and fruit

  440. A fingerprint is an _____________ characteristic; no two people have been found with the __________ same fingerprint pattern.

  441. About How many cups fruit does The USDA recommend eating each day?

    A. 2 cups B. 4 cups C. 8 cups D. 10 cups

  442. Which food would be poor nutritional choice to make from its food group?

    A. Apple pie- Fruit B. Cheddar cheese- dairy C. Salmon- Protein D. Sweet potato - vegetables

  443. A fingerprint pattern will remain _________ for the ________ of an individual.

  444. Find the circumference of the given circle. Round to the nearest tenth.

  445. Fingerprints have general characteristic _________ pattern that allow them to be systematically identified.

  446. Why does Myplate Plan suggest to choose skim or of 1% milk over whole?

    A. Skim and 1% have double the amount of Calcium Compared to whole B. Skim and 1% have the same amount of nutrients with less fat and Calories C. Skim and 1% are less expensive and can

  447. the system of equation showing his graph in the xy-plane x + y equals 12x - 3 y equals 17 determine the coordinates of the solutions of the system algebraically

  448. Which food group includes beans, peas, seafood and eggs?

    A. Protein B. Grains C. Vegetables D. Dairy

  449. clacify the triangle bye side 10 degrees by 20 degrees by 8 degrees

  450. Once a candidate is accepted into the Secret Service, he or she must complete which of the following? (1 point)

    Responses A. 10-week criminal investigator training program 1 B. 10-week special agent training course C. 18-week criminal investigator analysis

  451. clacify the triangle bye side 20 degrees by 10 degrees by 8 degrees

  452. 7. Your boss assigns you a task to estimate the relationship between per capita income

    and the percentage of labor force employed in the agricultural sector in ten developing countries. Your data are: Country A B C D E F G H I J Per capital income (Y) 6 8 8

  453. the system of equation showing his graph in the xy-plane x + y = 1

    2x - 3y = 17 determine the coordinates of the solutions of the system algebraically.

  454. Use the excerpt from the Treaty of Fort Laramie to answer the question. As demonstrated in the excerpt, the treaty PRIMARILY attempted to limit

    A. Native American land possession. B. Native American objection to railroads. C. the careers Native Americans

  455. Which sentence best describes the stories rising action?

    A. It is the points of a story where the characters work to resolve the conflict B. it describes how the main character was changed because of the plot events C. The provides a brief description of

  456. Which descriptive most accurately helps you visualize the story’s plot?

    A. A single point on a map B. A path C. A tree. D. In Ocean

  457. What is coefficient of determination

  458. How does the Sun affect the movement of water molecules to create motion in the ocean?

  459. Which of the following describes how the Catholic Church was a part of European culture in the Middle Ages?

    A. Most peasants learned how to read and write by attending a Catholic school. B. The Church pushed for people to use reason and to question those in

  460. What is the slides sorter view used for?

    A. Viewing the presentation notes B. Editing the slide content C. Changing the order of the slides D. Adding images to slides

  461. Why did the pope called for the Crusades?

    A. to take back the holy lands from Muslim control B. to fight against the Byzantine Empire and restore Catholic practices in that region C. to gain knowledge of the Muslim faith and bring it back to the people of

  462. What is the face of a title slide?

    A. To add titles to each slide B. To introduce the presentation C. To describe the resolution of a presentation D. To provide an outline of the presentation

  463. Properties of coefficient of determination

  464. How can a character develop impact plot development?

    A. The characters write the plot B. The characters choices often caused the conflicts in the story C. The character development is the same as a plot development. D. Character development is the conflict

  465. the function f is defined by F (x) equals (x - 5) ^ 2 - 24 all real numbers x what is the range of f?

  466. Your boss assigns you a task to estimate the relationship between per capita income

    and the percentage of labor force employed in the agricultural sector in ten developing countries. Your data are: Country A B C D E F G H I J Per capital income (Y) 6 8 8 7

  467. 87392 to nearest 100000

  468. What does the option to allow you to do in Microsoft PowerPoint?

    A. Add animation to clip art and text B. Add actions, such as fly-ins. Between slides. C.Create eight links to other slides, videos, or documents. D.Set up slideshow transitions

  469. What does the option to allow you to do in Microsoft PowerPoint?

    A. Add animation to clip art and text B. Add actions, such as fly-ins Between slides C. Create eight links to other slides, videos, or documents D. Set up slideshow transitions

  470. two functions f and g arrest in the xy-plane shown in which intervals do the solutions of the equation f (x) equals g (x) exist

  471. 6823617 to nearest 100000

  472. Derive coefficient of determination

  473. two functions f and g are graphed in the xy-plane shown. In which intervals do the solutions of the equation f (x) equals g (x) exist?

  474. 13415978 to nearest 100000

  475. How does an author develop a character in a story?

  476. Derivation of coefficient of determination

  477. 28469241 to nearest 100000

  478. Solve 8x>24.

  479. Solve x13<45

  480. Solve x 1/3 < 4/5

  481. Solve the inequality 4x>10

  482. As a town gets​ smaller, the population of its high school decreases by 5​% each year. The senior class has 320 students now. In how many years will it have about 100 ​students? Write an equation. Then solve the equation without graphing.

  483. Solve 8x+4≥52.

  484. 62−−√ is between which two integers on the number line?

    Responses 31 & 32 31 & 32 8 & 9 8 & 9 61 & 63 61 & 63 7 & 8

  485. Brianne is making apple pies. She has

    pounds of apples. Brianne estimates she can make 3 pies with no apples left over. What assumption did Brianne use to make this estimate? A. Each pie will need 5/6 pounds of apples. B. Each pie will need 6/6 pounds of

  486. What are the THREE most important qualities/characteristics YOU think an upstander should possess? Why are each of these qualities so important? Be sure to explain.

    If you need ideas, here are a few examples of qualities/characteristics: kind, empathetic,

  487. Solve 1/4x−3/4>5 1/4.

    Responses A: x>24 B: x>21 3/4 C: x>1 1/2 D: x>18

  488. Bob is buying the soccer team snacks after their game today. 8 players want cookies and 5 players want ice cream. If ice cream cost $1.25 each and cookies cost $1.75 each, how much will Bob spend on snacks for the team?

    A. $16.25 B. $18.75 C. $20.25 D.

  489. Put the steps in order for solving the equation:

    -2(4x - 8) + 2x = -5x + 10

  490. Put the steps in order for solving the equation:

    -2(4x - 8) + 2x = -5x + 10 Get the constants on one side: 6=x combine like terms: -6x+16=-5x+10 Distribute: -8x+16+2x=-5x+10 get the x-terms together on one side: 16=x+10

  491. For what values of x is the equation 34+x4=1 true?

    Responses x=7x is equal to 7 x=1x is equal to 1 x=−1x is equal to negative 1 x=−7x is equal to negative 7

  492. Which equation shows how to rewrite the sum of 42 and 54 using their greatest common factor?

    A.  54+42=6(9)+2(14) b.  54+42=3(18+14) c.  54+42=4(8)(3) d.  54+42=6(9+7)

  493. Joseph buys a gallon of milk every 6th day and a box of cereal every 8th day. He bought both items today. In how many days will he buy both items together again?

    A. 14 B. 18 C. 32 D. 24

  494. At 9:00 a.m., the temperature at an Arctic observatory was -12 f . By 5:00 p.m., the temperature had risen 5 degrees. Over the next three hours, the temperature had dropped 2 degrees.

    What was the temperature at 8:00 p.m.? A. -19 f B. -15 f C. -9 f D. 5

  495. How did Charlotte's letter impact her Girl Scout cookie sales? Why do you think her sales did that?

  496. the numbers represented by variables a and c , on the number line, are integers.

    __________________________ a c If , under which of the following conditions could the expression be true? A.when a=-5 and c=5 B.when a=0 andc=10 C.whena=7 and c=3 D.when a=-6

  497. When might be a time that YOU have to do the right thing if you see someone doing the wrong thing?

  498. he numbers represented by variables a and c , on the number line, are integers.

    __________________________ a c If , under which of the following conditions could the expression be true? A. when a=-5 and c=5 B. when a=0 and c=10 C. when a=7 and c=3 D. when

  499. Classify the triangle by it's sides and angles

  500. What association would you expect if graphing height and weight?

    A. positive B. nonlinear C. negative D. none of these

  501. the quadratic function f is defined as f (x) = -(x + 2)^2 + 3 consider the graph of y equals f(x) in the xy-plane. state whether there is a possible transformation of f in the form g(x) = f(x) + k, where k is a constant, for which the graph of y = g(x)

  502. what is a typical way to introduce yourself in Spanish

  503. Why did Robert Borba decide to take action?

  504. Can you describe a time when you've been honest, even when it was really difficult?

  505. Describe a time when you've been honest, even when it was really difficult?

  506. Which is the equation for terminal velocity?

    Vt= square root of w/2dACd Vt =square root of dACd/2w Vt =square root of 2m/dACd Vt= square root of 2w/dACd

  507. the quadratic function f is defined as f (x) = -(x + 2)^2 + 3 consider the graph of y equals f(x) in the xy-plane. state whether there is a possible transformation of f in the form g(x) = f(x + k), where k is constant, for which the graph of y = g(x) will

  508. Has there been some dishonesty in your past that you need to fix? Would you think about being honest and trying to fix that situation today? (You do not need to give specifics- just yes/no.)

  509. Has there been some dishonesty in your past that you need to fix? Would you think about being honest and trying to fix that situation today?

  510. Has there been some dishonesty in your past that you need to fix?

  511. Which of the following is true about a trend line for data?

    A. The minimum data point always lies on the trend line. B. Every data point must lie on the trend line. C. The trend line describes the pattern in the data if one exists. D. The trend line

  512. The temperature at 5:30 a.m. was –4° Fahrenheit (F). Eight hours later, at 2:30 p.m., the temperature is the opposite of –4 °F.

    The number line shows numbers from negative 8 to 8 in intervals of 1. The point A on negative 8, the point B is on negative

  513. the xy-plane shows a graph of the solutions to a system of inequalities if a and b are positive integers, the system consists of which inequalities?

  514. in which country would you call a bus an "omnibus"?

  515. Compare the color of light emitted by the spectrum tube without looking in the

    spectroscope to that observed through the spectroscope. Can you predict the spectral pattern by looking at the tube with only your naked eye?

  516. Sara and Tina are scuba diving. Sara is at –75 feet and Tina is at –125 feet. Which statement is true about Sara and Tina?

    A. Tina is diving deeper than Sara because |–125| is greater than |–75|. B. Tina is closer to the surface than Sara because

  517. For each one year period after a car was purchased its value at the end of the year was 15% less than its value at the beginning of the year. State whether the value of the car as a function of time after it was purchased is best modeled with a linear

  518. For each one year period after a car was purchased its value at the end of the year was 15% less than its value at the beginning of the year. If the value of the car 2 years after it was purchased is $17,918, what was the value of the car when it was

  519. Two lines do not intersect. Can you conclude that they are parallel? Explain.

  520. ="The figure shows an angle with a measure of 52 degrees."/>

    A. Find the complement of the angle shown. B. Find the supplement of the angle shown. Show all your work.

  521. Amelia used a $50 gift card to buy digital music online. After paying for 16 songs, her balance on the gift card was $30. What was the price of each song, assuming all songs cost the same amount?

    A. $3.13 B. $1.87 C. $1.25 D. $1.00

  522. Use the points in each diagram to name the figure shown.

    A line segment has a left endpoint, L, and a right endpoint, C. A line has a left plotted point, M, and a center plotted point, R. A line has a left plotted point, K, and a right plotted point, E. A

  523. Use the points in each diagram to name the figure shown.

    A line segment has a left endpoint, L, and a right endpoint, C.

  524. Use the points in each diagram to name the figure shown. A line segment has a left endpoint, L, and a right endpoint, C

  525. Katie's swim team is having an end-of-season pizza party. When the party started, there were 50 slices of pizza. Now there are 20 slices left. Which of the following shows how much of the pizza has been eaten?

    A. 20/50 B. 60% C. 40% D. 40/100

  526. Use the points in each diagram to name the figure shown. A line has a left plotted point, M, and a center plotted point, R.

  527. Angie bought 3 1/2 pounds of apples to make a pie. There are 16 ounces in one pound. How many ounces of apples did she buy?

    A. 16 B. 35 C. 56 D. 74

  528. A line segment has a left endpoint, L, and a right endpoint, C.

    A line has a left plotted point, M, and a center plotted point, R. A line has a left plotted point, K, and a right plotted point, E. A ray has a left endpoint, O, and a plotted point to the

  529. A line segment has a left endpoint, L, and a right endpoint, C.

  530. Evaluate the following expression when X=2 .

       3 X     +7X+2 A.24   B.22   C.10   D.9

  531. nnon is planning a surprise birthday party. She has to rent tables and chairs, and each table costs $35.00 and each chair costs $6.00. If the other costs of the party are $315.00, which of the following expressions represents the total cost of the party?

    A.

  532. Which of the following best describes how settlers traveled west

  533. Progressives like La Follette wanted voters to participate more directly in government. Since Andrew Jackson’s time, party leaders had picked candidates for local and state offices. Progressives called, instead, for primaries. In a primary, voters choose

  534. Name all the segments parallel to AD

  535. Name all the segments intersecting FG

  536. which country did the word zapato come from

  537. Name all the segments skew to BC⎯⎯⎯⎯⎯.

    b c bar Name all the segments intersecting AD⎯⎯⎯⎯⎯. eh d bar Name all the segments parallel to EH⎯⎯⎯⎯⎯⎯.

  538. which of the following geographical locations share borders whith spain?

  539. Name all the segments skew to BC⎯⎯⎯⎯⎯.

    b c bar

  540. What is a chloroplast? Explain how a root of a plant, that lacks Chloroplasts, gets energy.

  541. A slightly different meaning for a word than the dictionary/regular meaning

    Responses Technical Meaning Connotative Meaning

  542. Name all the segments intersecting AD⎯⎯⎯⎯⎯.

    eh d bar

  543. A slightly different meaning for a word than the dictionary/regular meaning

    Responses a.Technical Meaning b.Connotative Meaning

  544. Name all the segments parallel to EH⎯⎯⎯⎯⎯⎯.

  545. \Explain why animal cells do not require a cell wall or a central vacuole.

  546. Part of something written before or after a word to help explain the word

    Responses technical meaning context

  547. Part of something written before or after a word to help explain the word

    Responses A.technical meaning b.context

  548. Describe a route from A to B that includes Main St. and a street parallel to Main St.

    A square map shows an overhead view of 5 intersecting streets and 2 labeled points.

  549. For what values of x is the equation 34+x4=1 true?

  550. For what values of x is the equation 34+x4=1 true?

    x=7 x=1 x=-1 x=-7

  551. Use the map shown in Exercise 18. Describe a route from A to B that includes Oak St. and a street that intersects Oak St.

  552. A line segment has a left endpoint, A, and a right endpoint, B.

  553. solve the mass of a spherical ball varies as the cube of the radius and inversely as the surface area.when the radius is 14,area is 821,the mass is 59.4 find the equation connecting the relationship

  554. which energy resorce is nonrenewable

  555. Drag the correct answer to the box.

    1. Read the selection in the online textbook. 2. Start to fill out the Vocabulary Knowledge Rating Chart. 3. Take the lesson assessment. 4. Copy the Comprehension questions into the Lesson Note-Taking Organizer. Your

  556. The functions f and g are defined as follows. f(x) = -x + 2

    g(x) = x^2 - 1 The point (b,c) is on both the graph of f and the graph of g in the xy-plane. Which of the following inequalities must be true?

  557. What causes the moon’s appearance to change?

    Responses The rotation of the Earth Earth’s revolution around the Sun The rotation of the moon, , The moon’s revolution around the Earth

  558. solve the mass of a spherical ball varies as the cube of the radius and inversely as the surface area.when the radius is 14,area is 821,the mass is 59.4 find the equation connecting the relationship and mass when 1080,radius:9cm

  559. An object is dropped off the roof of a building. The function h(x) = -16x^2 + 64 models the height, h(x), in feet, of the object above the ground x seconds after it is dropped. What is the best description of the meaning of h(2) = 0 in terms of the

  560. Question

    Asad wants to make a model of the Earth and the moon. Which of these would be best to use? Responses Earth as a golf ball, moon as a soccer ball Earth as a basketball, moon as a tennis ball Earth as a basketball, moon as a soccer ball

  561. Which resource can be used up, but is considered renewable because it can replace itself?(1 point)

    Responses trees trees wind wind copper copper geothermal

  562. solve the mass of a spherical ball varies as the cube of the radius and inversely as the surface area.when the radius is 14,area is 821,the mass is 59.4 find the mass when 1080,radius:9cm

  563. Use the excerpt from the Sherman Antitrust Act to answer the question. The Sherman Antitrust Act made it illegal to

    A. restrain trade through contracts, trusts, and conspiracies. B. create business contracts that combined more than two companies. C. have

  564. Which question can a student ask to determine whether a resource is renewable or nonrenewable?(1 point)

    Responses Is the resource available naturally? Is the resource available naturally? Is there a practical use for the resource? Is there a practical use

  565. Which energy resource is nonrenewable?(1 point)

    Responses biomass biomass wind wind coal coal water

  566. Make a box-and-whisker plot for the set of data.

    21, 27, 27, 25, 21, 13, 18, 25

  567. Which statement provides evidence that petroleum is a nonrenewable resource?(1 point)

    Responses Petroleum harms the environment when it is used. Petroleum harms the environment when it is used. Many products are made from petroleum. Many products are made

  568. At night, the moon appears to be shining. Which statement explains why the moon looks this way?

    Responses The moon produces its own light. The moon reflects light from the Earth. The moon reflects light from the Sun.

  569. Which statement provides evidence that petroleum is a nonrenewable resource?(1 point)

    Responses Petroleum harms the environment when it is used. Petroleum harms the environment when it is used. Many products are made from petroleum. Many products are made

  570. Suppose a single light bulb burns out. How do you think this will affect lights that are strung along a single wire?

  571. A line segment has a left endpoint, A, and a right endpoint, B.

    A two-way arrow has a labeled point on the left, A, and a labeled point on the right, B. A left-arrow has a right endpoint, B, and a labeled point on the left, A.

  572. Tell whether each figure below contains ray AB .

    A line segment has a left endpoint, A, and a right endpoint, B.

  573. Tell whether each figure below contains ray AB . A line segment has a left endpoint, A, and a right endpoint, B.

    A two-way arrow has a labeled point on the left, A, and a labeled point on the right, B. A left-arrow has a right endpoint, B, and a labeled

  574. How will a single burned-out bulb affect the string of lights if each light is attached to its own wire?

  575. Are the rungs on a ladder parallel, intersecting, or skew?

  576. The quadratic function f is graphed in the xy-plane shown. The function will be transformed to form a second function, g. For which transformation of f will the equation f(x) = g(x) have 2 solutions?

  577. Draw each figure.

    AD←→ modified eh d with left right arrow above QW−→− q w vector PR←→ modified p r with left right arrow above FG⎯⎯⎯⎯⎯ f g barintersecting TU←→ modified t u with left right arrow above TB−→ t b vectorand

  578. Peter had $72 more than Leon. After Peter gave Leon $16, the ratio of the amount of money Peter had to the amount of money Leon had was

    5:3. Find the amount of money Peter had at first.

  579. 3 packets of potato chips and 5 packets of nuts cost $63. 1 packet of potato chips and 1 packet of nuts cost $15. How much would 1 packet of potato chips cost?

  580. Write this sentence in passive voice: "The jet flew into the clouds."

  581. The quadratic function f is graphed in the xy-plane shown. The function will be transformed to form a second function, g. For which transformation of f will the equation f(x) = g(x) have two

    solutions?

  582. Brennan wants to observe the moon as it completes one full orbit around the Earth. He plans to record the appearance of the moon in his journal. About how long will he need to make observations in order to view an entire cycle?

    Responses One day One day One

  583. are rocks considerd valuble natrul recoures

  584. A left-arrow has a right endpoint, Q, and a labeled point on the left, W

  585. FG⎯⎯⎯⎯⎯

    f g bar intersecting TU←→

  586. Earth and the other planets closest to the Sun are made mostly of _______

    A. Rocks B. Metal C. Water D. Gas

  587. Which type of weather front is depicted as a red line with semicircles pointing towards the direction of movement?

    A. Warm Front B. Stationary Front C. Occluded Front D. Cold Front

  588. The outside frame is an octagon. Inside the frame there are triangles, rectangles, trapezoids, and squares.

  589. What conditions would be predicted based on the information in the weather map?

    A. The advancing mass of cold air creates a low pressure area. B. The cold front advances without bringing any change in the weather. C. The high pressure causes cold air to

  590. A farmer has the windmill in the picture. The wind blows the windmill. The windmill pumps water. Which type of energy does the windmill use?

    A. solar B. water C. renewable D. nonrenewable

  591. Use the best names to identify the polygons in each pattern.

    Two tiles, labeled, A and b, respectively, show repeating, overlapping patterns of various polygons.

  592. Triangle DEF has vertices of D (-7, -1), E (-7, -8), and F (1, -8). Which of these statements is true about sides DE and EF?

    A. Side EF has a length of 6 units and is longer than side DE. B. Side DE has a length of 7 units and is longer than side EF. C.

  593. Jonesville is a rapidly growing city. Which of the following situations will most likely have a positive impact on the resources available to Jonesville?

    A. Builders cut down trees to build homes without replanting new ones. B. Most people water their lawns

  594. Rocks and Minerals Quick Check

    4 of 44 of 4 Items Question Why is copper considered to be a very valuable natural resource?(1 point) Responses Copper is the only mineral that can be classified as an ore Copper is the only mineral that can be classified as

  595. Are rocks considered valuable natural resources?(1 point)

    Responses Yes, rocks are valuable because they are useful to people. Yes, rocks are valuable because they are useful to people. Yes, rocks are valuable because they are part of Earth’s crust. Yes,

  596. Yes, rocks are valuable because they are useful to people.

    Yes, rocks are valuable because they are useful to people. Yes, rocks are valuable because they are part of Earth’s crust. Yes, rocks are valuable because they are part of Earth’s crust. No,

  597. The process by which water, ice, wind or gravity moves weathered rock and soil from one place to another.

    A. erosion B. deposition C. dumptruck D. weathering

  598. The Appalachian Mountains were once higher than they are now. Which of these explains why the Appalachians have become shorter over the years?

    A. plate movements B. volcanic eruptions C. deposition of sediments D. erosion by water and wind

  599. What are common uses of the mineral quartz?(1 point)

    Responses glass manufacturing and paints glass manufacturing and paints iron and steel production iron and steel production building and paving materials building and paving materials automobile

  600. Draw a trapezoid with a pair of congruent opposite sides.

  601. Plate A and Plate B are both made of continental plate material where they touch. What will happen as the plates press together?

    A. The edges of both plates will be pushed upward as the plates continue to move toward each other. B. The edges of both plates

  602. According to the picture, If these rock layers have been undisturbed, which layer is the youngest?

    A. B. C. D.

  603. The picture shows a fifty-two-million-year-old palm leaf fossil from a palm tree that was found in Wyoming. Palm trees with leaves similar to this fossil can be found living in tropical climates in the present day. Which of these best explains why a palm

  604. Which of these is an example of precipitation?

    A. Snow B. Air C. Vapor D. Clouds

  605. How do parallelograms and trapezoids differ? Explain.

  606. How do parallelograms and trapezoids differ? Explain.

  607. During a solar eclipse, what is the phase of the Moon?

    A. first quarter B. new C. full D. third quarter

  608. How does the Sun affect the movement of water molecules to create motion in the ocean?

    A. The Sun's energy heats water molecules causing them to rise as the cool water molecules rise, creating movement in the water. B. The Sun's energy cools water molecules

  609. In a class of 50 students the number of students who offer accounting is twice as the number who offer economics.10 students offer neither of the two subjects and 5 students offer both subjects.how many students offer accounting, how many students offer

  610. List all the names that apply to each figure.

    A four-sided polygon has 2 pair of parallel opposite sides. A polygon has 4 uneven sides and 4 different angles. A polygon has 4 congruent sides and 4 right angles.

  611. describe the relationshiopof input and output values for composite functions answer in 1 sentence

  612. explain how you know if a radical expression is in the simpilest form answer in one sentance

  613. Identify each polygon and classify it as regular or irregular. Explain.

    A pentagon has 5 equals sides and 5 equal angles measuring 108 degrees. A parallelogram has a base measuring 10 and a height measuring 4. A four-sided, polygon has 2 sides that measure

  614. with higher altitude or elevation?

    -Temperatures lower - Temperatures rise - The latitude increases - The latitude decreases

  615. how can you tell if radicals are like radicals answer in one sentance

  616. According to the passage, what can be inferred about how Elizabeth cadyStanton‘s personal qualities affected the woman suffrage movement?

  617. Use the best names to identify the polygons in each pattern.

    A tile shows a repeating, overlapping pattern of various polygons.

  618. is the inverse of a function always a function explain in one sentance

  619. Use the best names to identify the polygons in each pattern.

    A tile shows a repeating, overlapping pattern of various polygons. Image Long Description A tile shows repeating, overlapping pattern of various polygons. Image Long Description

  620. PLEASE HELP!!!!Which sentence is best structured to make a direct statement about one idea? A. NASA is known for sending humans to the moon, but the famous space program has also sent an unmanned spaceship to Mars, B. Some people think that NASA should

  621. a trapezoid with vertical sides parallel

  622. A right triangle is removed from a rectangle as shown in the figure below.

    A right triangle of height 9 m-m is removed from the rectangle of length 18 m-m and width 15 m-m. The length to the left of the removed triangle is 3 m-m and to the right is 9 m-m.

  623. A gift box has dimensions of:

    inches, inches, and inches, respectively. How many cubes with side lengths of inches would be needed to fill the gift box? A. 116.875 cubes B. 163.5 cubes C. 935 cubes D. 1,870 cubes

  624. Use this coordinate grid to help you answer the question below.

    Kaycee draws PQRS on a coordinate grid. The coordinates of three of the vertices are , , and . If PQRS is a parallelogram, what are the coordinates of point S? A. B. C.

  625. two squares, the second of which has twice the perimeter of the first Find the length of a side of a regular decagon that has a perimeter of 22 ft.

  626. classify each quadrilateral in the photos below. Then name the parallel sides.

    A patch of land is outlined in the shape of a four-sided polygon, labeled A B C D. It has two pairs of opposite parallel sides. Angles A and C are congruent. Angles B and D are

  627. Which of the following conclusions is supported by the chart ?

    Average time spent on math homework by student grade level shows minutes per night from 10 to 30 in increments of 5 on the vertical axis and grades 5, 6, 7, 8 on the horizontal axis with a bar

  628. Which graph shows data that are clustered about the center, with no outliers?

    A. The line plot shows numbers from 0 to 10 in increments of 1 has one X above all the numbers. B. The line plot shows numbers from 0 to 10 in increments of 1. There is one X

  629. List all side lengths and angle measures you can find for each polygon.

    rhombus WXYZ , WX= 4 cm comma w x equals 4 cm rectangle JKLN , KL= 5 in. comma k l equals 5 in parallelogram ABCD , AB= 6 cm, m∠A= 115° comma eh b equals 6 cm comma m angle eh equals

  630. Normal

    Kelly is brainstorming research projects and needs to write a list of possible statistical questions. Which of the following questions should not be included in her list? A. What is the average lifespan of humpback whales? B. How many astronauts have

  631. A group of 15 students were assigned a novel to read during class. The data below represents the number of pages each student read.

    8, 8, 10, 11, 12, 12, 13, 14, 16, 16, 18, 18, 18, 20, 24 Which of the following box plots correctly summarizes the data? A.

  632. List all side lengths and angle measures you can find for each polygon.

    rhombus WXYZ , WX= 4 cm

  633. The table below shows how many minutes Mary spent exercising each day for the last two weeks.

    Mary's Time Spent Exercising Sun Mon Tue Wed Thu Fri Sat Week 1 0 min 45 min 45 min 40 min 50 min 35 min 0 min Week 2 0 min 45 min 50 min 45 min 40 min 50 min 35

  634. The 5 employees at Jewelry Hut are scheduled to work an average of 31 hours each next week, as shown below.

    A table labeled Employee hours scheduled. Alan has 24 hours, Susan has 39 hours, Craig has 24 hours, Mary has 40 hours and Scott has 28 hours. The

  635. List all side lengths and angle measures you can find for each polygon.

    comma w x equals 4 cm rectangle JKLN , KL= 5 in. comma k l equals 5 in parallelogram ABCD , AB= 6 cm, m∠A= 115° comma eh b equals 6 cm comma m angle eh equals 115 degrees

  636. List all side lengths and angle measures you can find for each polygon.

    rectangle JKLN , KL= 5 in. comma k l equals 5 in parallelogram ABCD , AB= 6 cm, m∠A= 115°

  637. What does it mean that a source of energy is nonrenewable?(1 point)

    Responses Once used, it needs to be reprocessed for reuse. Once used, it needs to be reprocessed for reuse. There is only a limited supply that can be used. There is only a limited supply

  638. Please never go on brainly because I got harassed so I answered a question of somebodies and im an 11 year old girl in middle school sixth grade right this girl says be my girlfriend! she also says i wanna make out with u make out and she also says im in

  639. In the equation: (x^-5)/(x^-7)

    Why is the x^-7 moved to the numerator and changed to a positive instead of x^-5? Or at least, how do you know which number needs to be changed to a positive number

  640. Sqrt 7x (sqrt x -7 sqrt 7 )

  641. 3sqrt32a - 6sqrt3 2a

  642. Are kids allowed to run away? Is there a law that protects them? What is that law?

  643. The lifespan of a black bear is 3 years longer than the lifespan of a zebra. Write an addition equation that you could use to find the lifespan of a zebra. Black bears lifespan years: 18

  644. why was stephen austin able to establish a colony in mexican territory

  645. The lifespan of a black bear is 3 years longer than the lifespan of a zebra. Write an addition equation that you could use to find the lifespan of a zebra.

  646. The lifespan of a black bear is 3 years longer than the lifespan of a zebra. Write an addition that you could use to find the lifespan of a zebra. Lifespan of a black bear years: 18 lifespan of a zebra: ?

  647. Find the percent of of increase or decrease.

    The price of a radio changes from $40.00 to $44.00

  648. Annika sorenstam won the 2006 Mastercard classic with a final score of 8 under par, or -8. Her scores for the first two of the three rounds were -5 and -1. What was ms. Sorenstams score for the third round?

  649. Which issue did the Great Compromise address?

    Congressional representation election of the president membership of the Supreme Court relationship of the states to each other

  650. Monica earned twice as much as Samuel mowing lawns. If Monica earned $48, how much did Samuel earn?

  651. Mary wants to put 4 geraniums in each pot. If she had 8 pots, how many geraniums should she buy?

  652. In: y^2 + 6y - 9, where y = -9,

    Is the answer 16 + 6y or 6y + 16, or does the order not matter?

  653. There are 8 competitors in each ring for a tae Kwon do tournament. If there are 96 competitors in the tournament, how many rings do they need?

  654. The mcclarens sold their house in Orlando, Florida, for $300,000. They split the income evenly among their four children. How much did each child get?

  655. The cost of 6 motorcycles is equal to the cost of one SUV. If the SUV costs $30,000, find the cost of one motorcycle.

  656. The number of eighth graders in choir is three times the number of seventh graders. If there are 48 eighth graders in choir, how many seventh graders are in choir?

  657. Carmen has a rope 54 feet long. She wants to cut it into 6 foot lengths to make jump ropes for the members of the jump roping team. How many jump ropes can Carmen make?

  658. The amount of rainfall on Monday and Thursday is shown in the table. If the same amount of rain that fell on Monday fell for 3 days and the same account that fell on Thursday fell for 2 days, how much rain would fall over those 5 days?